Construct: ORF TRCN0000481031
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016579.1_s317c1
- Derived from:
- ccsbBroadEn_11009
- DNA Barcode:
- TTCTTCCCATCAGATCGGTGATAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OPCML (4978)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481031
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319106.1 | 99.9% | 99.7% | 487C>T |
| 2 | human | 4978 | OPCML | opioid binding protein/cell... | NM_002545.4 | 99.6% | 99.4% | 487C>T;526_528delGAA |
| 3 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319103.1 | 97% | 96.8% | 487C>T;526_528delGAA;937_963del |
| 4 | human | 4978 | OPCML | opioid binding protein/cell... | XM_006718846.3 | 94.9% | 93% | (many diffs) |
| 5 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001012393.3 | 94.6% | 92.7% | (many diffs) |
| 6 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319105.1 | 87.7% | 87.5% | 0_1ins123;364C>T;403_405delGAA |
| 7 | human | 4978 | OPCML | opioid binding protein/cell... | XM_011542856.3 | 87.7% | 87.5% | 0_1ins123;364C>T;403_405delGAA |
| 8 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319104.2 | 70.6% | 70.4% | 0_1ins300;187C>T;226_228delGAA |
| 9 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510438.3 | 91.9% | 98.2% | (many diffs) |
| 10 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510437.3 | 91.6% | 97.9% | (many diffs) |
| 11 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510435.3 | 89.6% | 95.7% | (many diffs) |
| 12 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510434.3 | 89.3% | 95.4% | (many diffs) |
| 13 | mouse | 330908 | Opcml | opioid binding protein/cell... | NM_177906.4 | 87% | 91.5% | (many diffs) |
| 14 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_011242559.2 | 84.6% | 88.9% | (many diffs) |
| 15 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510439.3 | 78% | 83.8% | (many diffs) |
| 16 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510440.2 | 62.6% | 67.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1101
- ORF length:
- 1032
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggggtctgt gggtacctgt tcctgccctg gaagtgcctc gtggtcgtgt 121 ctctcaggct gctgttcctt gtacccacag gagtgcccgt gcgcagcgga gatgccacct 181 tccccaaagc tatggacaac gtgacggtcc ggcaggggga gagcgccacc ctcaggtgta 241 ccatagatga ccgggtaacc cgggtggcct ggctaaaccg cagcaccatc ctctacgctg 301 ggaatgacaa gtggtccata gaccctcgtg tgatcatcct ggtcaataca ccaacccagt 361 acagcatcat gatccaaaat gtggatgtgt atgacgaagg tccgtacacc tgctctgtgc 421 agacagacaa tcatcccaaa acgtcccggg ttcacctaat agtgcaagtt cctcctcaga 481 tcatgaatat ctcctcagac atcactgtga atgagggaag cagtgtgacc ctgctgtgtc 541 ttgctattgg cagatcagag ccaactgtga catggagaca cctgtcagtc aagggccagg 601 gctttgtaag tgaggatgag tacctggaga tctctgacat caagcgagac cagtccgggg 661 agtacgaatg cagcgcgttG AACGATGTCG CTGCGCCCGA TGTGCGGAAA GTAAAAATCA 721 CTGTAAACTA TCCTCCCTAT ATCTCAAAAG CCAAGAACAC TGGTGTTTCA GTCGGTCAGA 781 AGGGCATCCT GAGCTGTGAA GCCTCTGCAG TCCCCATGGC TGAATTCCAG TGGTTCAAGG 841 AAGAAACCAG GTTAGCCACT GGTCTGGATG GAATGAGGAT TGAAAACAAA GGCCGCATGT 901 CCACTCTGAC TTTCTTCAAT GTTTCAGAAA AGGATTATGG GAACTATACT TGTGTGGCCA 961 CGAACAAGCT TGGGAACACC AATGCCAGCA TCACATTGTA TGGGCCTGGA GCAGTCATTG 1021 ATGGTGTAAA CTCGGCCTCC AGAGCACTGG CTTGTCTCTG GCTATCAGGG ACCCTCTTAG 1081 CCCACTTCTT CATCAAGTTT TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1141 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1201 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATTCT TCCCATCAGA 1261 TCGGTGATAT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt