Transcript: Mouse XM_006510440.2

PREDICTED: Mus musculus opioid binding protein/cell adhesion molecule-like (Opcml), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Opcml (330908)
Length:
1674
CDS:
753..1517

Additional Resources:

NCBI RefSeq record:
XM_006510440.2
NBCI Gene record:
Opcml (330908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510440.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113637 GCCTACCCAATACAGTATCAT pLKO.1 734 5UTR 100% 5.625 7.875 N Opcml n/a
2 TRCN0000113636 CCGCATATCCACTTTGACTTT pLKO.1 1280 CDS 100% 4.950 6.930 N Opcml n/a
3 TRCN0000113639 GAAGCAGTGTGACCCTGTTAT pLKO.1 901 CDS 100% 13.200 9.240 N Opcml n/a
4 TRCN0000113638 GCACCTGATGTTCGGAAAGTA pLKO.1 1080 CDS 100% 5.625 3.938 N Opcml n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510440.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488056 CACGACTAATCCAGAACAAGACAC pLX_317 30.2% 62.9% 67.7% V5 (many diffs) n/a
2 TRCN0000488347 AGTGCCATTTAGCATCCTCTTTTT pLX_317 30.5% 62.9% 67.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_06672 pDONR223 100% 62.9% 67.5% None (many diffs) n/a
4 ccsbBroad304_06672 pLX_304 0% 62.9% 67.5% V5 (many diffs) n/a
5 TRCN0000466912 TAACGGTAGTCAGATCAGTGCATC pLX_317 30.4% 62.9% 67.5% V5 (many diffs) n/a
6 ccsbBroadEn_11009 pDONR223 100% 62.6% 67.2% None (many diffs) n/a
7 ccsbBroad304_11009 pLX_304 0% 62.6% 67.2% V5 (many diffs) n/a
8 TRCN0000481031 TTCTTCCCATCAGATCGGTGATAT pLX_317 40.9% 62.6% 67.2% V5 (many diffs) n/a
Download CSV