Transcript: Human NM_001319106.1

Homo sapiens opioid binding protein/cell adhesion molecule like (OPCML), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
OPCML (4978)
Length:
7108
CDS:
546..1580

Additional Resources:

NCBI RefSeq record:
NM_001319106.1
NBCI Gene record:
OPCML (4978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359093 TACATCCAAGTGTCCTATTAT pLKO_005 2005 3UTR 100% 15.000 21.000 N OPCML n/a
2 TRCN0000363270 GCCCGATGTGCGGAAAGTAAA pLKO_005 1172 CDS 100% 13.200 18.480 N OPCML n/a
3 TRCN0000363359 CCACGTGTAGGATAATCATTC pLKO_005 1787 3UTR 100% 10.800 15.120 N OPCML n/a
4 TRCN0000154899 GAGCAGTCATTGATGGTGTAA pLKO.1 1486 CDS 100% 4.950 6.930 N OPCML n/a
5 TRCN0000156430 CGGGTTCACCTAATAGTGCAA pLKO.1 924 CDS 100% 2.640 3.696 N OPCML n/a
6 TRCN0000363310 GTAAACTATCCTCCCTATATC pLKO_005 1200 CDS 100% 13.200 9.240 N OPCML n/a
7 TRCN0000152271 CATGAATATCTCCTCAGACAT pLKO.1 959 CDS 100% 4.950 3.465 N OPCML n/a
8 TRCN0000155364 CAGTACAGCATCATGATCCAA pLKO.1 834 CDS 100% 3.000 2.100 N OPCML n/a
9 TRCN0000156832 GCAGACAGACAATCATCCCAA pLKO.1 896 CDS 100% 2.640 1.848 N OPCML n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11009 pDONR223 100% 99.9% 99.7% None 487C>T n/a
2 ccsbBroad304_11009 pLX_304 0% 99.9% 99.7% V5 487C>T n/a
3 TRCN0000481031 TTCTTCCCATCAGATCGGTGATAT pLX_317 40.9% 99.9% 99.7% V5 487C>T n/a
4 TRCN0000488056 CACGACTAATCCAGAACAAGACAC pLX_317 30.2% 99.7% 99.7% V5 525_526insGAA n/a
5 TRCN0000488347 AGTGCCATTTAGCATCCTCTTTTT pLX_317 30.5% 99.7% 99.7% V5 (not translated due to prior stop codon) 525_526insGAA n/a
6 ccsbBroadEn_06672 pDONR223 100% 99.6% 99.4% None 347C>A;525_526insGAA n/a
7 ccsbBroad304_06672 pLX_304 0% 99.6% 99.4% V5 347C>A;525_526insGAA n/a
8 TRCN0000466912 TAACGGTAGTCAGATCAGTGCATC pLX_317 30.4% 99.6% 99.4% V5 347C>A;525_526insGAA n/a
Download CSV