Transcript: Human XM_011542856.3

PREDICTED: Homo sapiens opioid binding protein/cell adhesion molecule like (OPCML), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OPCML (4978)
Length:
18224
CDS:
478..1392

Additional Resources:

NCBI RefSeq record:
XM_011542856.3
NBCI Gene record:
OPCML (4978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359093 TACATCCAAGTGTCCTATTAT pLKO_005 1817 3UTR 100% 15.000 21.000 N OPCML n/a
2 TRCN0000363270 GCCCGATGTGCGGAAAGTAAA pLKO_005 984 CDS 100% 13.200 18.480 N OPCML n/a
3 TRCN0000363359 CCACGTGTAGGATAATCATTC pLKO_005 1599 3UTR 100% 10.800 15.120 N OPCML n/a
4 TRCN0000154899 GAGCAGTCATTGATGGTGTAA pLKO.1 1298 CDS 100% 4.950 6.930 N OPCML n/a
5 TRCN0000156430 CGGGTTCACCTAATAGTGCAA pLKO.1 733 CDS 100% 2.640 3.696 N OPCML n/a
6 TRCN0000363310 GTAAACTATCCTCCCTATATC pLKO_005 1012 CDS 100% 13.200 9.240 N OPCML n/a
7 TRCN0000152271 CATGAATATCTCCTCAGACAT pLKO.1 768 CDS 100% 4.950 3.465 N OPCML n/a
8 TRCN0000155364 CAGTACAGCATCATGATCCAA pLKO.1 643 CDS 100% 3.000 2.100 N OPCML n/a
9 TRCN0000156832 GCAGACAGACAATCATCCCAA pLKO.1 705 CDS 100% 2.640 1.848 N OPCML n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488056 CACGACTAATCCAGAACAAGACAC pLX_317 30.2% 88.1% 88.1% V5 0_1ins123 n/a
2 TRCN0000488347 AGTGCCATTTAGCATCCTCTTTTT pLX_317 30.5% 88.1% 88.1% V5 (not translated due to prior stop codon) 0_1ins123 n/a
3 ccsbBroadEn_06672 pDONR223 100% 88% 87.8% None 0_1ins123;224C>A n/a
4 ccsbBroad304_06672 pLX_304 0% 88% 87.8% V5 0_1ins123;224C>A n/a
5 TRCN0000466912 TAACGGTAGTCAGATCAGTGCATC pLX_317 30.4% 88% 87.8% V5 0_1ins123;224C>A n/a
6 ccsbBroadEn_11009 pDONR223 100% 87.7% 87.5% None 0_1ins123;364C>T;403_405delGAA n/a
7 ccsbBroad304_11009 pLX_304 0% 87.7% 87.5% V5 0_1ins123;364C>T;403_405delGAA n/a
8 TRCN0000481031 TTCTTCCCATCAGATCGGTGATAT pLX_317 40.9% 87.7% 87.5% V5 0_1ins123;364C>T;403_405delGAA n/a
Download CSV