Construct: ORF TRCN0000481120
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003574.1_s317c1
- Derived from:
- ccsbBroadEn_12840
- DNA Barcode:
- CCTCATACGGCACTATCATCACTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CAPS2 (84698)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481120
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84698 | CAPS2 | calcyphosine 2 | XM_005269194.3 | 100% | 100% | |
| 2 | human | 84698 | CAPS2 | calcyphosine 2 | XM_017020039.1 | 83.6% | 83.7% | 879_1050delinsT |
| 3 | human | 84698 | CAPS2 | calcyphosine 2 | NM_001286548.3 | 76.6% | 76.7% | 215_310del;975_1146delinsT |
| 4 | human | 84698 | CAPS2 | calcyphosine 2 | NM_001355030.2 | 76.6% | 76.7% | 215_310del;975_1146delinsT |
| 5 | human | 84698 | CAPS2 | calcyphosine 2 | NM_001355031.2 | 76.6% | 76.7% | 215_310del;975_1146delinsT |
| 6 | human | 84698 | CAPS2 | calcyphosine 2 | NM_001355032.2 | 76.6% | 76.7% | 215_310del;975_1146delinsT |
| 7 | human | 84698 | CAPS2 | calcyphosine 2 | NM_001355033.2 | 76.6% | 76.7% | 215_310del;975_1146delinsT |
| 8 | human | 84698 | CAPS2 | calcyphosine 2 | XM_017020036.1 | 76.6% | 76.7% | 215_310del;975_1146delinsT |
| 9 | human | 84698 | CAPS2 | calcyphosine 2 | NM_001355027.2 | 62.2% | 62.2% | 1_438del;653_748del |
| 10 | human | 84698 | CAPS2 | calcyphosine 2 | NM_001286547.3 | 61.6% | 61.6% | 1_546del |
| 11 | human | 84698 | CAPS2 | calcyphosine 2 | NM_001355026.2 | 61.3% | 61.4% | 1_381del;1260_1431delinsT |
| 12 | human | 84698 | CAPS2 | calcyphosine 2 | XM_005269192.1 | 57.6% | 57.6% | 1_378del;593_688del;1353_1524delinsT |
| 13 | human | 84698 | CAPS2 | calcyphosine 2 | XM_011538888.1 | 57.4% | 57.5% | 1_381del;596_691del;1356_1527delinsT |
| 14 | human | 84698 | CAPS2 | calcyphosine 2 | NM_001355025.2 | 55.4% | 55.4% | 1_438del;653_748del;1413_1584delinsT |
| 15 | human | 84698 | CAPS2 | calcyphosine 2 | XM_011538887.2 | 53.7% | 53.8% | 1_582del;1461_1632delinsT |
| 16 | human | 84698 | CAPS2 | calcyphosine 2 | NM_032606.5 | 52.6% | 52.6% | 1_696del;911_1006del |
| 17 | human | 84698 | CAPS2 | calcyphosine 2 | NM_001355024.2 | 51.8% | 51.9% | 1_546del;761_856del;1521_1692delinsT |
| 18 | human | 84698 | CAPS2 | calcyphosine 2 | XM_024449226.1 | 51.7% | 51.7% | 1_552del;767_862del;1527_1698delinsT |
| 19 | human | 84698 | CAPS2 | calcyphosine 2 | NM_001355023.2 | 51.3% | 51.4% | 1_660del;1539_1710delinsT |
| 20 | human | 84698 | CAPS2 | calcyphosine 2 | XM_011538886.2 | 50.8% | 50.8% | 1_582del;797_892del;1557_1728delinsT |
| 21 | human | 84698 | CAPS2 | calcyphosine 2 | XM_006719649.2 | 50.2% | 50.3% | 1_696del;1575_1746delinsT |
| 22 | human | 84698 | CAPS2 | calcyphosine 2 | XM_011538878.1 | 48.6% | 48.6% | 1_660del;875_970del;1635_1806delinsT |
| 23 | human | 84698 | CAPS2 | calcyphosine 2 | XM_011538889.3 | 48.6% | 48.6% | 1_660del;875_970del;1635_1806delinsT |
| 24 | human | 84698 | CAPS2 | calcyphosine 2 | XM_006719648.2 | 47.6% | 47.7% | 1_696del;911_1006del;1671_1842delinsT |
| 25 | human | 84698 | CAPS2 | calcyphosine 2 | XM_011538890.1 | 30.3% | 30.1% | (many diffs) |
| 26 | human | 84698 | CAPS2 | calcyphosine 2 | XR_944789.1 | 24.4% | 1_893del;1108_1203del;1868_3585delinsT | |
| 27 | human | 84698 | CAPS2 | calcyphosine 2 | NR_149156.2 | 16.2% | 1_412del;552_553ins169;1122_4207delinsT | |
| 28 | human | 84698 | CAPS2 | calcyphosine 2 | NR_149155.2 | 16% | 1_440del;580_581ins169;1150_4235delinsT | |
| 29 | human | 84698 | CAPS2 | calcyphosine 2 | NR_149161.2 | 15.9% | 1_486del;626_627ins169;1196_4281delinsT | |
| 30 | human | 84698 | CAPS2 | calcyphosine 2 | NR_149159.2 | 14.8% | 1_816del;956_957ins169;1526_4611delinsT | |
| 31 | human | 84698 | CAPS2 | calcyphosine 2 | NR_149157.2 | 14.7% | 1_844del;984_985ins169;1554_4639delinsT | |
| 32 | human | 84698 | CAPS2 | calcyphosine 2 | NR_149160.2 | 14.6% | 1_876del;1016_1017ins169;1586_4671delinsT |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 945
- ORF length:
- 879
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat agaccactta tctagggctg tcatcagtga tccagagcaa aatttagcca 121 ttgagcaaaa agaaagtgat catatccttc cagattcaaa gatgacacct cttcgattta 181 gaaaaagaac actacatgaa acaaagataa gaactcattc tacattaact gaaaatgtgc 241 tttctcataa attacagttt gatggtagga tcgtatcacg aacaaatgtg cttcctttta 301 ttcaaaaaag catttatagt catcagtgtg gacgaagaaa aggaaaacaa taccgacttg 361 gtgattttta tgttggtgca accttgacat ttttgagttc tgatcatctc agccttccag 421 aaagcatcaa agaaaacaca ttacttaaac tccgaatcac aaatattgat caaatagctt 481 tggattctct caaaactgct tctatggaac aggaggatga tataatcatt caagaaacca 541 atgataggct ggtcttcaaa gcaattcaag atgtgctaaa agaaaaacta cataaaagag 601 gtgttcgtat tttgactgga ttggGAAAAT ATTTTCAACA GTTGGACAAG GAAGGAAATG 661 GACTTTTAGA TAAGGCAGAT TTTAAGCAAG CTCTAAAAGT GTTTCACTTA GAAGTGTCTG 721 AAAAGGATTT TGAGTCTGCA TGGCTAATTC TGAATGACAA TGGCAATGGC AAGGTTGATT 781 ATGGAGAATT CAAACGTGGT ATTATTGGTG AAATGAATGA ATACAGGAAA TCATATGTTC 841 GAAAGGCCTT TATGAAACTG GATTTCAACA AAAGTGGCAG TGTGCCTATT ATAAACATAA 901 GAAAATGTTA CTGTGCAAAG AAGCATTCTC AAGTAATTTC AGGTTGCCCA ACTTTCTTGT 961 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1021 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1081 GAAAGGACGA CCTCATACGG CACTATCATC ACTGACGCGT TAAGTCgaca atcaacctct 1141 ggattacaaa atttgtgaaa gatt