Transcript: Human NR_149161.2

Homo sapiens calcyphosine 2 (CAPS2), transcript variant 19, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CAPS2 (84698)
Length:
4281
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_149161.2
NBCI Gene record:
CAPS2 (84698)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_149161.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429071 GCAGACAACTCTTGCGATAAA pLKO_005 363 3UTR 100% 13.200 18.480 N CAPS2 n/a
2 TRCN0000053305 CACATTACTTAAACTCCGAAT pLKO.1 689 3UTR 100% 4.050 3.240 N CAPS2 n/a
3 TRCN0000434362 TTGAGTCTGCATGGCTAATTC pLKO_005 982 3UTR 100% 13.200 9.240 N CAPS2 n/a
4 TRCN0000053306 GCAAAGAAGCATTCTCAAGTA pLKO.1 1167 3UTR 100% 4.950 3.465 N CAPS2 n/a
5 TRCN0000053304 GCAAGGTTGATTATGGAGAAT pLKO.1 1021 3UTR 100% 4.950 3.465 N CAPS2 n/a
6 TRCN0000053303 GCAAGTCTGATGAAGTGTCAT pLKO.1 1255 3UTR 100% 4.950 3.465 N CAPS2 n/a
7 TRCN0000053307 GCTTCTATGGAACAGGAGGAT pLKO.1 750 3UTR 100% 2.640 1.848 N CAPS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_149161.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12840 pDONR223 100% 15.9% None 1_486del;626_627ins169;1196_4281delinsT n/a
2 ccsbBroad304_12840 pLX_304 0% 15.9% V5 1_486del;626_627ins169;1196_4281delinsT n/a
3 TRCN0000481120 CCTCATACGGCACTATCATCACTG pLX_317 36.8% 15.9% V5 1_486del;626_627ins169;1196_4281delinsT n/a
4 ccsbBroadEn_14312 pDONR223 100% 14.2% None 1_755del;771G>A;1368_4281del n/a
5 ccsbBroad304_14312 pLX_304 0% 14.2% V5 1_755del;771G>A;1368_4281del n/a
6 TRCN0000473503 AGCACACTTCGTAACCTGTACTCC pLX_317 76% 14.2% V5 1_755del;771G>A;1368_4281del n/a
Download CSV