Transcript: Human XM_017025272.1

PREDICTED: Homo sapiens kinase suppressor of ras 1 (KSR1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KSR1 (8844)
Length:
6693
CDS:
1288..3648

Additional Resources:

NCBI RefSeq record:
XM_017025272.1
NBCI Gene record:
KSR1 (8844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006230 GTGCCAGAAGAGCATGATATT pLKO.1 1962 CDS 100% 13.200 10.560 N KSR1 n/a
2 TRCN0000338414 GTGCCAGAAGAGCATGATATT pLKO_005 1962 CDS 100% 13.200 10.560 N KSR1 n/a
3 TRCN0000338476 TCGTACACAAAGATCTCAAAT pLKO_005 3062 CDS 100% 13.200 10.560 N KSR1 n/a
4 TRCN0000382498 ACGGCGTGAGAACCAGCTAAA pLKO_005 3165 CDS 100% 10.800 8.640 N KSR1 n/a
5 TRCN0000021535 CCTAGAGATAGGAACAGTCAT pLKO.1 5688 3UTR 100% 4.950 3.960 N LOC400588 n/a
6 TRCN0000006229 GCTGCCTACTTCATTCATCAT pLKO.1 2344 CDS 100% 4.950 3.960 N KSR1 n/a
7 TRCN0000338417 CCTTATTGCAGAAAGTTTAAA pLKO_005 2418 CDS 100% 15.000 10.500 N KSR1 n/a
8 TRCN0000021536 CTCGTGAGCATCACAGTTAAA pLKO.1 5614 3UTR 100% 13.200 9.240 N LOC400588 n/a
9 TRCN0000380689 TCATCATAGACAGCAGTTTAT pLKO_005 2358 CDS 100% 13.200 9.240 N KSR1 n/a
10 TRCN0000006226 GCCTCCTTATTGCAGAAAGTT pLKO.1 2414 CDS 100% 5.625 3.938 N KSR1 n/a
11 TRCN0000021534 CCTGTGTTATTCTGTGTTGAT pLKO.1 6331 3UTR 100% 4.950 3.465 N LOC400588 n/a
12 TRCN0000021538 GAAGCGCTCATTGAGCAACTA pLKO.1 5635 3UTR 100% 4.950 3.465 N LOC400588 n/a
13 TRCN0000021537 TGTATTTCAGTGACTGTGAAT pLKO.1 5893 3UTR 100% 4.950 3.465 N LOC400588 n/a
14 TRCN0000006227 GCTCTTCAAGAAAGAGGTGAT pLKO.1 2832 CDS 100% 0.405 0.284 N KSR1 n/a
15 TRCN0000338415 GCTCTTCAAGAAAGAGGTGAT pLKO_005 2832 CDS 100% 0.405 0.284 N KSR1 n/a
16 TRCN0000361300 AGACGTCTCTGGACATCAATA pLKO_005 2981 CDS 100% 13.200 18.480 N Ksr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14915 pDONR223 72.3% 95.7% 59.9% None (many diffs) n/a
2 ccsbBroad304_14915 pLX_304 0% 95.7% 59.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481419 ATCCCTCTAAATTAGTAATAGAAA pLX_317 19.1% 95.7% 59.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV