Transcript: Mouse XM_011248771.3

PREDICTED: Mus musculus kinase suppressor of ras 1 (Ksr1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ksr1 (16706)
Length:
5702
CDS:
255..2957

Additional Resources:

NCBI RefSeq record:
XM_011248771.3
NBCI Gene record:
Ksr1 (16706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248771.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361298 AGAGTCTGTCCCGTCAGATAT pLKO_005 1424 CDS 100% 13.200 18.480 N Ksr1 n/a
2 TRCN0000361297 TCATCAAGGGCATGGGTTATC pLKO_005 2254 CDS 100% 10.800 15.120 N Ksr1 n/a
3 TRCN0000022527 GTCCGGTAATCCAAAGATGTA pLKO.1 2936 CDS 100% 4.950 6.930 N Ksr1 n/a
4 TRCN0000361299 CCCGAGATCGTACGAGAAATG pLKO_005 2445 CDS 100% 10.800 8.640 N Ksr1 n/a
5 TRCN0000022526 CCGATGAAGTTTGAACTCCCT pLKO.1 1185 CDS 100% 0.660 0.528 N Ksr1 n/a
6 TRCN0000361300 AGACGTCTCTGGACATCAATA pLKO_005 2209 CDS 100% 13.200 9.240 N Ksr1 n/a
7 TRCN0000022528 CATGGGTTATCTTCATGCAAA pLKO.1 2264 CDS 100% 4.950 3.465 N Ksr1 n/a
8 TRCN0000022525 CATCAATAAGACTAGGCAGAT pLKO.1 2222 CDS 100% 4.050 2.835 N Ksr1 n/a
9 TRCN0000022524 GCTGGTGAAATACATTTGCAA pLKO.1 485 CDS 100% 3.000 2.100 N Ksr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248771.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14915 pDONR223 72.3% 65% 39.8% None (many diffs) n/a
2 ccsbBroad304_14915 pLX_304 0% 65% 39.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481419 ATCCCTCTAAATTAGTAATAGAAA pLX_317 19.1% 65% 39.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV