Construct: ORF TRCN0000481449
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008770.2_s317c1
- Derived from:
- ccsbBroadEn_06654
- DNA Barcode:
- CGGGGTCGACTAGCAAACTTCTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NPM1 (4869)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481449
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4869 | NPM1 | nucleophosmin 1 | NM_001355006.1 | 99.8% | 100% | 456A>G |
| 2 | human | 4869 | NPM1 | nucleophosmin 1 | NM_002520.6 | 99.8% | 100% | 456A>G |
| 3 | human | 4869 | NPM1 | nucleophosmin 1 | NM_199185.3 | 90% | 90.1% | 456A>G;579_580ins87 |
| 4 | human | 4869 | NPM1 | nucleophosmin 1 | NM_001037738.3 | 87.7% | 87.4% | (many diffs) |
| 5 | human | 4869 | NPM1 | nucleophosmin 1 | NM_001355007.1 | 78.1% | 78.2% | 0_1ins192;264A>G |
| 6 | human | 4869 | NPM1 | nucleophosmin 1 | NM_001355009.2 | 77.8% | 77.5% | (many diffs) |
| 7 | human | 4869 | NPM1 | nucleophosmin 1 | NM_001355010.1 | 56.6% | 56.8% | 57_58ins294;162A>G;285_286ins87 |
| 8 | human | 4869 | NPM1 | nucleophosmin 1 | NR_149149.1 | 52% | 1_245del;641_642ins128;1000_1321del | |
| 9 | human | 29121 | CLEC2D | C-type lectin domain family... | NR_036693.3 | 15.4% | (many diffs) | |
| 10 | mouse | 18148 | Npm1 | nucleophosmin 1 | NM_008722.3 | 90.1% | 94.9% | (many diffs) |
| 11 | mouse | 18148 | Npm1 | nucleophosmin 1 | NM_001252260.1 | 86.2% | 90.5% | (many diffs) |
| 12 | mouse | 18148 | Npm1 | nucleophosmin 1 | NM_001252261.1 | 78.7% | 82.3% | (many diffs) |
| 13 | mouse | 102639044 | LOC102639044 | nucleophosmin pseudogene | XR_389514.3 | 55.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 948
- ORF length:
- 882
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga agattcgatg gacatggaca tgagccccct gaggccccag aactatcttt 121 tcggttgtga actaaaggcc gacaaagatt atcactttaa ggtggataat gatgaaaatg 181 agcaccagtt atctttaaga acggtcagtt taggggctgg tgcaaaggat gagttgcaca 241 ttgttgaagc agaggcaatg aattacgaag gcagtccaat taaagtaaca ctggcaactt 301 tgaaaatgtc tgtacagcca acggtttccc ttgggggctt tgaaataaca ccaccagtgg 361 tcttaaggtt gaagtgtggt tcagggccag tgcatattag tggacagcac ttagtagctg 421 tggaggaaga tgcagagtca gaagatgaag aggaggagga tgtgaaactc ttaagtatat 481 ctggaaagcg gtctgcccct GGAGGTGGTA GCAAGGTTCC GCAGAAAAAA GTAAAACTTG 541 CTGCTGATGA AGATGATGAC GATGATGATG AAGAGGATGA TGATGAAGAT GATGATGATG 601 ATGATTTTGA TGATGAGGAA GCTGAAGAAA AAGCGCCAGT GAAGAAATCT ATACGAGATA 661 CTCCAGCCAA AAATGCACAA AAGTCAAATC AGAATGGAAA AGACTCAAAA CCATCATCAA 721 CACCAAGATC AAAAGGACAA GAATCCTTCA AGAAACAGGA AAAAACTCCT AAAACACCAA 781 AAGGACCTAG TTCTGTAGAA GACATTAAAG CAAAAATGCA AGCAAGTATA GAAAAAGGTG 841 GTTCTCTTCC CAAAGTGGAA GCCAAATTCA TCAATTATGT GAAGAATTGC TTCCGGATGA 901 CTGACCAAGA GGCTATTCAA GATCTCTGGC AGTGGAGGAA GTCTCTTTAC CCAACTTTCT 961 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1021 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1081 GTGGAAAGGA CGACGGGGTC GACTAGCAAA CTTCTCGACG CGTTAAGTCg acaatcaacc 1141 tctggattac aaaatttgtg aaagatt