Transcript: Human NM_001355009.2

Homo sapiens nucleophosmin 1 (NPM1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
NPM1 (4869)
Length:
1513
CDS:
101..793

Additional Resources:

NCBI RefSeq record:
NM_001355009.2
NBCI Gene record:
NPM1 (4869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355009.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062271 GCAAAGGATGAGTTGCACATT pLKO.1 257 CDS 100% 4.950 3.465 N NPM1 n/a
2 TRCN0000298626 TTACGAAGGCAGTCCAATTAA pLKO_005 298 CDS 100% 15.000 9.000 N NPM1 n/a
3 TRCN0000062269 GCCGACAAAGATTATCACTTT pLKO.1 173 CDS 100% 4.950 2.970 N NPM1 n/a
4 TRCN0000298629 GTTCAGGGCCAGTGCATATTA pLKO_005 414 CDS 100% 15.000 7.500 Y NPM1 n/a
5 TRCN0000062272 CCTAGTTCTGTAGAAGACATT pLKO.1 734 CDS 100% 4.950 2.475 Y NPM1 n/a
6 TRCN0000286484 CCTAGTTCTGTAGAAGACATT pLKO_005 734 CDS 100% 4.950 2.475 Y NPM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355009.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01107 pDONR223 100% 86.5% 86% None (many diffs) n/a
2 ccsbBroad304_01107 pLX_304 0% 86.5% 86% V5 (many diffs) n/a
3 TRCN0000471859 CTTGTCTTCTCCATATCTTTCTCA pLX_317 46.6% 86.5% 86% V5 (many diffs) n/a
4 ccsbBroadEn_06655 pDONR223 100% 78% 77.5% None (many diffs) n/a
5 ccsbBroad304_06655 pLX_304 0% 78% 77.5% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000469435 GATTGGGAGCTCAAATAACAAACG pLX_317 51.8% 78% 77.5% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_15511 pDONR223 0% 77.8% 77.2% None (many diffs) n/a
8 ccsbBroad304_15511 pLX_304 0% 77.8% 77.2% V5 (many diffs) n/a
9 ccsbBroadEn_06654 pDONR223 100% 77.8% 77.5% None (many diffs) n/a
10 ccsbBroad304_06654 pLX_304 0% 77.8% 77.5% V5 (many diffs) n/a
11 TRCN0000481449 CGGGGTCGACTAGCAAACTTCTCG pLX_317 50.7% 77.8% 77.5% V5 (many diffs) n/a
12 ccsbBroadEn_15510 pDONR223 0% 77.8% 77.2% None (many diffs) n/a
13 ccsbBroad304_15510 pLX_304 0% 77.8% 77.2% V5 (many diffs) n/a
14 ccsbBroadEn_15512 pDONR223 0% 50.7% 50.3% None (many diffs) n/a
15 ccsbBroad304_15512 pLX_304 0% 50.7% 50.3% V5 (many diffs) n/a
16 TRCN0000468440 CTTAAATGGTTTCAAGAATTCAAC pLX_317 70.5% 50.7% 50.3% V5 (many diffs) n/a
Download CSV