Transcript: Mouse NM_001252260.1

Mus musculus nucleophosmin 1 (Npm1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Npm1 (18148)
Length:
1401
CDS:
228..1067

Additional Resources:

NCBI RefSeq record:
NM_001252260.1
NBCI Gene record:
Npm1 (18148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115429 GCAGTGGAGGAAATCTCTTTA pLKO.1 1046 CDS 100% 13.200 9.240 N Npm1 n/a
2 TRCN0000115428 GCAGAAGCAATGAACTATGAA pLKO.1 372 CDS 100% 5.625 3.938 N Npm1 n/a
3 TRCN0000335127 GCAGAAGCAATGAACTATGAA pLKO_005 372 CDS 100% 5.625 3.938 N Npm1 n/a
4 TRCN0000115426 GCCAAGAATGTGTTGTCTAAA pLKO.1 1197 3UTR 100% 13.200 6.600 Y Npm1 n/a
5 TRCN0000335204 GCCAAGAATGTGTTGTCTAAA pLKO_005 1197 3UTR 100% 13.200 6.600 Y Npm1 n/a
6 TRCN0000062272 CCTAGTTCTGTAGAAGACATT pLKO.1 903 CDS 100% 4.950 2.475 Y NPM1 n/a
7 TRCN0000286484 CCTAGTTCTGTAGAAGACATT pLKO_005 903 CDS 100% 4.950 2.475 Y NPM1 n/a
8 TRCN0000115430 GCAGAGTCTGAAGATGAAGAT pLKO.1 555 CDS 100% 4.950 2.475 Y Npm1 n/a
9 TRCN0000335128 GCAGAGTCTGAAGATGAAGAT pLKO_005 555 CDS 100% 4.950 2.475 Y Npm1 n/a
10 TRCN0000140258 GAAGATGAAGATGAGGAGGGA pLKO.1 564 CDS 100% 0.660 0.330 Y MEA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06654 pDONR223 100% 86.2% 90.5% None (many diffs) n/a
2 ccsbBroad304_06654 pLX_304 0% 86.2% 90.5% V5 (many diffs) n/a
3 TRCN0000481449 CGGGGTCGACTAGCAAACTTCTCG pLX_317 50.7% 86.2% 90.5% V5 (many diffs) n/a
4 ccsbBroadEn_06655 pDONR223 100% 86.2% 90.1% None (many diffs) n/a
5 ccsbBroad304_06655 pLX_304 0% 86.2% 90.1% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000469435 GATTGGGAGCTCAAATAACAAACG pLX_317 51.8% 86.2% 90.1% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_15510 pDONR223 0% 86.2% 90.1% None (many diffs) n/a
8 ccsbBroad304_15510 pLX_304 0% 86.2% 90.1% V5 (many diffs) n/a
9 ccsbBroadEn_15511 pDONR223 0% 86.1% 89.8% None (many diffs) n/a
10 ccsbBroad304_15511 pLX_304 0% 86.1% 89.8% V5 (many diffs) n/a
11 ccsbBroadEn_01107 pDONR223 100% 78% 81.9% None (many diffs) n/a
12 ccsbBroad304_01107 pLX_304 0% 78% 81.9% V5 (many diffs) n/a
13 TRCN0000471859 CTTGTCTTCTCCATATCTTTCTCA pLX_317 46.6% 78% 81.9% V5 (many diffs) n/a
14 ccsbBroadEn_15512 pDONR223 0% 68.9% 70.9% None (many diffs) n/a
15 ccsbBroad304_15512 pLX_304 0% 68.9% 70.9% V5 (many diffs) n/a
16 TRCN0000468440 CTTAAATGGTTTCAAGAATTCAAC pLX_317 70.5% 68.9% 70.9% V5 (many diffs) n/a
Download CSV