Construct: ORF TRCN0000487752
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020076.1_s317c1
- DNA Barcode:
- TAGTTCACCCCAGACCCGAATCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KRAS (3845)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487752
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3845 | KRAS | KRAS proto-oncogene, GTPase | NM_004985.3:c.38G>A | 99.8% | 99.4% | 564_565insG |
| 2 | human | 3845 | KRAS | KRAS proto-oncogene, GTPase | NM_001369787.1 | 99.6% | 98.9% | 38G>A;564_565insG |
| 3 | human | 3845 | KRAS | KRAS proto-oncogene, GTPase | NM_004985.5 | 99.6% | 98.9% | 38G>A;564_565insG |
| 4 | human | 3845 | KRAS | KRAS proto-oncogene, GTPase | NM_001369786.1 | 90.2% | 88.9% | (many diffs) |
| 5 | human | 3845 | KRAS | KRAS proto-oncogene, GTPase | NM_033360.4 | 90.2% | 88.9% | (many diffs) |
| 6 | mouse | 16653 | Kras | Kirsten rat sarcoma viral o... | NM_021284.6 | 93.2% | 96.2% | (many diffs) |
| 7 | mouse | 16653 | Kras | Kirsten rat sarcoma viral o... | XM_006506918.3 | 86.2% | 88.9% | (many diffs) |
| 8 | mouse | 16653 | Kras | Kirsten rat sarcoma viral o... | XM_006506919.3 | 77.2% | 79.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 639
- ORF length:
- 567
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgactgaa tataaacttg tggtagttgg agctggtgac gtaggcaaga 121 gtgccttgac gatacagcta attcagaatc attttgtgga cgaatatgat ccaacaatag 181 aggattccta caggaagcaa gtagtaattg atggagaaac ctgtctcttg gatattctcg 241 acacagcagg tcaagaggag tacagtgcaa tgagggacca gtacatgagg actggggagg 301 gctttctttg tgtatttgcc ataaataata ctaaatcatt tgaagatatt caccattata 361 gagaacaaat taaaagagtt aaggactctg aagatgtacc tatggtccta gtaggaaata 421 aatgtgattt gccTTCTAGA ACAGTAGACA CAAAACAGGC TCAGGACTTA GCAAGAAGTT 481 ATGGAATTCC TTTTATTGAA ACATCAGCAA AGACAAGACA GGGTGTTGAT GATGCCTTCT 541 ATACATTAGT TCGAGAAATT CGAAAACATA AAGAAAAGAT GAGCAAAGAT GGTAAAAAGA 601 AGAAAAAGAA GTCAAAGACA AAGTGTGTAA TTATGGACCC AGCTTTCTTG TACAAAGTGG 661 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 721 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 781 ATAGTTCACC CCAGACCCGA ATCAAACGCG TTAAGTCgac aatcaacctc tggattacaa 841 aatttgtgaa agatt