Transcript: Human NM_033360.4

Homo sapiens KRAS proto-oncogene, GTPase (KRAS), transcript variant a, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
KRAS (3845)
Length:
5430
CDS:
191..760

Additional Resources:

NCBI RefSeq record:
NM_033360.4
NBCI Gene record:
KRAS (3845)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033360.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033261 GATCCGACAATACAGATTGAA pLKO.1 676 CDS 100% 5.625 7.875 N KRAS n/a
2 TRCN0000033259 GCAGACGTATATTGTATCATT pLKO.1 4337 3UTR 100% 5.625 7.875 N KRAS n/a
3 TRCN0000010369 CAGTTGAGACCTTCTAATTGG pLKO.1 1282 3UTR 100% 4.950 3.960 N KRAS n/a
4 TRCN0000352609 CAGTTGAGACCTTCTAATTGG pLKO_005 1282 3UTR 100% 4.950 3.960 N KRAS n/a
5 TRCN0000377271 CCTTGACGATACAGCTAATTC pLKO_005 243 CDS 100% 13.200 9.240 N KRAS n/a
6 TRCN0000033263 GACGAATATGATCCAACAATA pLKO.1 278 CDS 100% 13.200 9.240 N KRAS n/a
7 TRCN0000033260 GAGGGCTTTCTTTGTGTATTT pLKO.1 416 CDS 100% 13.200 9.240 N KRAS n/a
8 TRCN0000363721 GAGGGCTTTCTTTGTGTATTT pLKO_005 416 CDS 100% 13.200 9.240 N KRAS n/a
9 TRCN0000034384 GCCTTGACGATACAGCTAATT pLKO.1 242 CDS 100% 13.200 9.240 N Kras n/a
10 TRCN0000369099 TGAAGATATTCACCATTATAG pLKO_005 460 CDS 100% 13.200 9.240 N KRAS n/a
11 TRCN0000033262 CCTATGGTCCTAGTAGGAAAT pLKO.1 518 CDS 100% 10.800 7.560 N KRAS n/a
12 TRCN0000332882 CCTATGGTCCTAGTAGGAAAT pLKO_005 518 CDS 100% 10.800 7.560 N KRAS n/a
13 TRCN0000040151 CCTACAGGAAGCAAGTAGTAA pLKO.1 306 CDS 100% 5.625 3.938 N KRAS n/a
14 TRCN0000040149 GATGCCTTCTATACATTAGTT pLKO.1 774 3UTR 100% 5.625 3.938 N KRAS n/a
15 TRCN0000040150 CTCAGGACTTAGCAAGAAGTT pLKO.1 579 CDS 100% 4.950 3.465 N KRAS n/a
16 TRCN0000055356 GAGAAACCTGTCTCTTGGATA pLKO.1 333 CDS 100% 4.950 3.465 N Kras n/a
17 TRCN0000055357 CAAGTAGTAATTGATGGAGAA pLKO.1 317 CDS 100% 4.050 2.835 N Kras n/a
18 TRCN0000301869 CAAGTAGTAATTGATGGAGAA pLKO_005 317 CDS 100% 4.050 2.835 N Kras n/a
19 TRCN0000040152 AGGACTCTGAAGATGTACCTA pLKO.1 501 CDS 100% 3.000 2.100 N KRAS n/a
20 TRCN0000018337 TAGTTGGAGCTGGTGGCGTAG pLKO.1 213 CDS 100% 0.750 0.525 N KRAS n/a
21 TRCN0000040148 CCTCGTTTCTACACAGAGAAA pLKO.1 4029 3UTR 100% 0.495 0.347 N KRAS n/a
22 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3365 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033360.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488169 GAACCACTCCTATCCCCCATGTTT pLX_317 59.8% 99.8% 99.4% V5 (not translated due to prior stop codon) 38G>A n/a
2 TRCN0000488343 CTATAAAAACTCAAGTCCGGTCCC pLX_317 54.9% 90.5% 89.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_16173 pDONR223 0% 90.3% 89.4% None (many diffs) n/a
4 ccsbBroad304_16173 pLX_304 0% 90.3% 89.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489180 TCGGCGACTATGAATTTCTAAAAT pLX_317 67.2% 90.3% 89.4% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000487752 TAGTTCACCCCAGACCCGAATCAA pLX_317 36.1% 90.2% 88.9% V5 (many diffs) n/a
Download CSV