Construct: ORF TRCN0000487904
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021173.1_s317c1
- DNA Barcode:
- CACACATTTATCAATTGGGTTTGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR137B (7107)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487904
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7107 | GPR137B | G protein-coupled receptor ... | NM_003272.4 | 100% | 100% | |
| 2 | human | 7107 | GPR137B | G protein-coupled receptor ... | XM_017002209.2 | 93.2% | 91.9% | (many diffs) |
| 3 | human | 7107 | GPR137B | G protein-coupled receptor ... | XM_017002210.2 | 89.2% | 89.2% | 837_838ins129 |
| 4 | human | 7107 | GPR137B | G protein-coupled receptor ... | XR_247039.4 | 17.5% | 1_94del;1186_1333del;1440_6819del | |
| 5 | mouse | 83924 | Gpr137b | G protein-coupled receptor ... | NM_031999.2 | 86.6% | 91.2% | (many diffs) |
| 6 | mouse | 83924 | Gpr137b | G protein-coupled receptor ... | XM_006516805.3 | 80.2% | 82% | (many diffs) |
| 7 | mouse | 664862 | Gpr137b-ps | G protein-coupled receptor ... | NR_003568.1 | 36% | (many diffs) | |
| 8 | mouse | 83924 | Gpr137b | G protein-coupled receptor ... | XR_382078.1 | 27.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1269
- ORF length:
- 1197
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaggccc gagcgtcccc ggccgcgcgg cagcgccccc ggcccgatgg 121 agaccccgcc gtgggaccca gcccgcaacg actcgctgcc gcccacgctg accccggccg 181 tgccccccta cgtgaagctt ggcctcaccg tcgtctacac cgtgttctac gcgctgctct 241 tcgtgttcat ctacgtgcag ctctggctgg tgctgcgtta ccgccacaag cggctcagct 301 accagagcgt cttcctcttt ctctgcctct tctgggcctc cctgcggacc gtcctcttct 361 ccttctactt caaagacttc gtggcggcca attcgctcag ccccttcgtc ttctggctgc 421 tctactgctt ccctgtgtgc ctgcagtttt tcaccctcac gctgatgaac ttgtacttca 481 cgcaggtgat tttcaaagcc aagtcaaaat attctccaga attactcaaa taccggttgc 541 ccctctacct ggcctccctc ttcatcagcc ttgttttcct gttggtgaat ttaacctgtg 601 ctgtgctggt aaagacggga aattgggaga ggaaggttat cgtctctgtg cgagtggcca 661 ttaatgacac gctcttcgtg ctgtgtgccg tctctctctc catctgtctc tacaaaatct 721 ctaagatgtc cttagccaac atttacttgg agtccaaggg ctcctccgtg tgtcaagtga 781 ctgccatcgg tgtcaccgtg atactgcttt acacctctcg ggcctgctac aacctgttca 841 tcctgtcatt ttctcagaac aagagcgtcc attcctttga ttatgactgg tacaatgtat 901 cagaccaggc agatttgaag aatcagctgg gagatgctgg atacgtatta tttggagtgg 961 tgttatttgt ttgggaactc ttacctacca ccTTAGTCGT TTATTTCTTC CGAGTTAGAA 1021 ATCCTACAAA GGACCTTACC AACCCTGGAA TGGTCCCCAG CCATGGATTC AGTCCCAGAT 1081 CTTATTTCTT TGACAACCCT CGAAGATATG ACAGTGATGA TGACCTTGCC TGGAACATTG 1141 CCCCTCAGGG ACTTCAGGGA GGTTTTGCTC CAGATTACTA TGATTGGGGA CAACAAACTA 1201 ACAGCTTCCT GGCACAAGCA GGAACTTTGC AAGACTCAAC TTTGGATCCT GACAAACCAA 1261 GCCTTGGGTA GGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1321 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1381 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACAC ACATTTATCA ATTGGGTTTG 1441 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t