Transcript: Mouse XM_006516805.3

PREDICTED: Mus musculus G protein-coupled receptor 137B (Gpr137b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpr137b (83924)
Length:
1993
CDS:
744..1925

Additional Resources:

NCBI RefSeq record:
XM_006516805.3
NBCI Gene record:
Gpr137b (83924)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516805.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241828 CTCCTCTTCGTGTTCATCTAT pLKO_005 861 CDS 100% 5.625 2.813 Y Gpr137b n/a
2 TRCN0000243491 CCCGTGTGTCTACAGTTCTTC pLKO_005 1059 CDS 100% 4.950 2.475 Y Gpr137b n/a
3 TRCN0000243490 CGCTCATGAACTTGTACTTCA pLKO_005 1087 CDS 100% 4.950 2.475 Y Gpr137b n/a
4 TRCN0000241829 CTTCACCCTCACGCTCATGAA pLKO_005 1076 CDS 100% 4.950 2.475 Y Gpr137b n/a
5 TRCN0000173595 GAGCTACTCAAATACCGGTTA pLKO.1 1146 CDS 100% 4.050 2.025 Y Gpr137b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516805.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01682 pDONR223 100% 80.2% 82% None (many diffs) n/a
2 ccsbBroad304_01682 pLX_304 0% 80.2% 82% V5 (many diffs) n/a
3 TRCN0000492142 ATGCTTGCTGGTTTATCGGAATTG pLX_317 23% 80.2% 82% V5 (many diffs) n/a
4 TRCN0000492027 TCCTTTATCAAACAGACGACCCCC pLX_317 27.8% 80.1% 82% V5 (many diffs) n/a
5 TRCN0000487904 CACACATTTATCAATTGGGTTTGA pLX_317 23.6% 80.2% 82% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV