Transcript: Human XM_017002210.2

PREDICTED: Homo sapiens G protein-coupled receptor 137B (GPR137B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR137B (7107)
Length:
6542
CDS:
95..1165

Additional Resources:

NCBI RefSeq record:
XM_017002210.2
NBCI Gene record:
GPR137B (7107)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141583 CCACATTGGTAGACTCCTAAA pLKO.1 1638 3UTR 100% 10.800 15.120 N GPR137B n/a
2 TRCN0000141482 CACGCTGATGAACTTGTACTT pLKO.1 481 CDS 100% 4.950 3.465 N GPR137B n/a
3 TRCN0000140290 GCAGGAACTTTGCAAGACTCA pLKO.1 1112 CDS 100% 2.640 1.848 N GPR137B n/a
4 TRCN0000359563 ATTCAGTCCCAGATCTTATTT pLKO_005 961 CDS 100% 15.000 9.000 N GPR137B n/a
5 TRCN0000141186 CCTCTTCTCCTTCTACTTCAA pLKO.1 376 CDS 100% 4.950 2.475 Y GPR137B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01682 pDONR223 100% 89.2% 89.2% None 837_838ins129 n/a
2 ccsbBroad304_01682 pLX_304 0% 89.2% 89.2% V5 837_838ins129 n/a
3 TRCN0000492142 ATGCTTGCTGGTTTATCGGAATTG pLX_317 23% 89.2% 89.2% V5 837_838ins129 n/a
4 TRCN0000492027 TCCTTTATCAAACAGACGACCCCC pLX_317 27.8% 89.1% 89% V5 837_838ins129;1068_1069insG n/a
5 TRCN0000487904 CACACATTTATCAATTGGGTTTGA pLX_317 23.6% 89.2% 89.2% V5 (not translated due to prior stop codon) 837_838ins129 n/a
Download CSV