Construct: ORF TRCN0000487991
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019542.1_s317c1
- DNA Barcode:
- GGCATAGCGAACAGCCTCTTCGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR161 (23432)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487991
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267610.1 | 99.9% | 99.8% | 1587_1588insG |
| 2 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349632.1 | 99.9% | 99.8% | 1587_1588insG |
| 3 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349633.1 | 99.9% | 99.8% | 1587_1588insG |
| 4 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349634.1 | 99.9% | 99.8% | 1587_1588insG |
| 5 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_153832.2 | 99.9% | 99.8% | 1587_1588insG |
| 6 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_005245056.2 | 99.9% | 99.8% | 1587_1588insG |
| 7 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_005245057.4 | 99.9% | 99.8% | 1587_1588insG |
| 8 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509376.2 | 99.9% | 99.8% | 1587_1588insG |
| 9 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509378.1 | 99.9% | 99.8% | 1587_1588insG |
| 10 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267611.1 | 96.8% | 96.7% | 1_51del;1638_1639insG |
| 11 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267609.1 | 96.2% | 96.1% | 1_60del;1647_1648insG |
| 12 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_005245055.2 | 96.2% | 96.1% | 1_60del;1647_1648insG |
| 13 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_006711251.1 | 95.7% | 95.6% | 1_69del;1656_1657insG |
| 14 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509371.2 | 95.7% | 95.6% | 1_69del;1656_1657insG |
| 15 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509372.1 | 95.7% | 95.6% | 1_69del;1656_1657insG |
| 16 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509373.2 | 95.7% | 95.6% | 1_69del;1656_1657insG |
| 17 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_006711253.2 | 86.8% | 86.7% | 1_240del;1827_1828insG |
| 18 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267613.1 | 81.5% | 71.9% | (many diffs) |
| 19 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267614.1 | 77.7% | 76.7% | (many diffs) |
| 20 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267612.1 | 75% | 74.9% | 0_1ins396;1191_1192insG |
| 21 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349635.1 | 75% | 74.9% | 0_1ins396;1191_1192insG |
| 22 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | NM_001310430.1 | 87.8% | 92.6% | (many diffs) |
| 23 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_006496850.3 | 87.8% | 92.6% | (many diffs) |
| 24 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_006496851.3 | 87.8% | 92.6% | (many diffs) |
| 25 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_006496852.3 | 87.8% | 92.6% | (many diffs) |
| 26 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_011238821.2 | 87.8% | 92.6% | (many diffs) |
| 27 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | NM_001310429.1 | 85.1% | 89.7% | (many diffs) |
| 28 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | NM_001081126.2 | 83.1% | 87.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1665
- ORF length:
- 1590
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgagc ctcaactcct ccctcagctg caggaaggag ctgagtaatc 121 tcactgagga ggagggtggc gaagggggcg tcatcatcac ccagttcatc gccatcattg 181 tcatcaccat ttttgtctgc ctgggaaacc tggtcatcgt ggtcaccttg tacaagaagt 241 cctacctcct caccctcagc aacaagttcg tcttcagcct gactctgtcc aacttcctgc 301 tgtccgtgtt ggtgctgcct tttgtggtga cgagctccat ccgcagggaa tggatctttg 361 gtgtagtgtg gtgcaacttc tctgccctcc tctacctgct gatcagctct gccagcatgc 421 taaccctcgg ggtcattgcc atcgaccgct actatgctgt cctgtacccc atggtgtacc 481 ccatgaagat cacagggaac cgggctgtga tggcacttgt ctacatctgg cttcactcgc 541 tcatcggctg cctgccaccc ctgtttggtt ggtcatccgt ggagtttgac gagttcaaat 601 ggatgtgtgt ggctgcttgg caccgggagc ctggctacac ggccttctgg cagatctggt 661 gtgccctctt cccctttctg gtcatgctgg tgtgctatgg cttcatcttc cgcgtggcca 721 gggtcaaggc acgcaaggtg cactgtggca cagtcgtcat cgtggaggag gatgctcaga 781 ggaccgggag gaagaactcc agcacctcca cctcctcttc aggcagcagg aggaatgcct 841 ttcagggtgt ggtctactcg gccaaccagt gcaaagccct catcaccatc ctggtggtcc 901 tcggtgcctt catggtcacc tggggcccct acatggttgt catcgcctct gaggccctct 961 gggggaaaag ctccgtctcc ccgagcctgg agacttgggc cacatggctg tcctttgcca 1021 gcgctgtctg ccaccccctg atctatggac tctggaacaa gacagttcgc aaagaactac 1081 tgggcatgtg ctttggggac cggtattatc gggaaccatt tgtgcaacga cagaggactt 1141 ccaggctctt cagcatttcc aacaggatca cagacctggg cctgtcccca cacctcactg 1201 cgctcatggc aggtggacag cccctggggc acagcagcag cacgggggac actggcttca 1261 gctgctccca ggactcaggg acagatatga tgctgcttga ggactacacg tctgatgaca 1321 accctccctc tcactgcact tgcccaccCA AGAGAAGGAG CTCGGTGACA TTTGAGGATG 1381 AAGTGGAACA AATCAAAGAA GCTGCCAAGA ACTCGATTCT TCATGTGAAA GCTGAAGTAC 1441 ACAAGTCCTT GGACAGTTAC GCAGCAAGCT TGGCCAAAGC CATTGAGGCC GAAGCCAAAA 1501 TCAACTTATT TGGGGAGGAG GCTTTGCCAG GGGTCTTGGT TACAGCACGG ACTGTCCCGG 1561 GGGGCGGCTT CGGGGGCCGC CGAGGCAGCA GAACTCTTGT GAGCCAGAGG CTGCAGTTGC 1621 AGAGCATCGA AGAAGGAGAT GTTTTAGCTG CCGAGCAGAG AGACCCAGCT TTCTTGTACA 1681 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1741 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1801 AGGACGAGGC ATAGCGAACA GCCTCTTCGT CACGCGTTAA GTCgacaatc aacctctgga 1861 ttacaaaatt tgtgaaagat t