Transcript: Human NM_001267613.1

Homo sapiens G protein-coupled receptor 161 (GPR161), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
GPR161 (23432)
Length:
7664
CDS:
312..1667

Additional Resources:

NCBI RefSeq record:
NM_001267613.1
NBCI Gene record:
GPR161 (23432)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267613.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255425 ACTCGATTCTTCATGTGAAAG pLKO_005 1414 CDS 100% 10.800 15.120 N GPR161 n/a
2 TRCN0000358079 CGGTATTATCGGGAACCATTT pLKO_005 1104 CDS 100% 10.800 15.120 N GPR161 n/a
3 TRCN0000255423 GTTGGTCATCCGTGGAGTTTG pLKO_005 571 CDS 100% 10.800 15.120 N GPR161 n/a
4 TRCN0000014228 CCGGTATTATCGGGAACCATT pLKO.1 1103 CDS 100% 4.950 6.930 N GPR161 n/a
5 TRCN0000014230 CGAGTTCAAATGGATGTGTGT pLKO.1 593 CDS 100% 2.640 3.696 N GPR161 n/a
6 TRCN0000014231 CCTGATCTATGGACTCTGGAA pLKO.1 1040 CDS 100% 2.640 2.112 N GPR161 n/a
7 TRCN0000255424 AGAAGGAGCTCGGTGACATTT pLKO_005 1356 CDS 100% 13.200 9.240 N GPR161 n/a
8 TRCN0000255427 ATGGGACCAGAAGCATCTAAA pLKO_005 1898 3UTR 100% 13.200 9.240 N GPR161 n/a
9 TRCN0000358086 AGTCCACAGCTTCAGCATTTC pLKO_005 1841 3UTR 100% 10.800 7.560 N GPR161 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6054 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6055 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267613.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02766 pDONR223 100% 81.5% 72% None (many diffs) n/a
2 ccsbBroad304_02766 pLX_304 0% 81.5% 72% V5 (many diffs) n/a
3 TRCN0000471229 GAAGTCACCCTACTTATAAGCTCG pLX_317 26.5% 81.5% 72% V5 (many diffs) n/a
4 TRCN0000488861 CGGATCCTCTTTTATTGTACGGTT pLX_317 21.7% 81.5% 72% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487991 GGCATAGCGAACAGCCTCTTCGTC pLX_317 20% 81.5% 71.9% V5 (many diffs) n/a
Download CSV