Transcript: Mouse NM_001081126.2

Mus musculus G protein-coupled receptor 161 (Gpr161), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gpr161 (240888)
Length:
6854
CDS:
117..1793

Additional Resources:

NCBI RefSeq record:
NM_001081126.2
NBCI Gene record:
Gpr161 (240888)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081126.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257039 CCATCCGGAGGGAATGGATTT pLKO_005 466 CDS 100% 10.800 8.640 N Gpr161 n/a
2 TRCN0000239013 CCTTCAAGGAGTGGTCTATTC pLKO_005 968 CDS 100% 10.800 7.560 N Gpr161 n/a
3 TRCN0000239014 TACGCAGCCAGCTTGGCTAAA pLKO_005 1587 CDS 100% 10.800 7.560 N Gpr161 n/a
4 TRCN0000014229 CCTCAGCAACAAGTTCGTCTT pLKO.1 383 CDS 100% 4.050 2.835 N GPR161 n/a
5 TRCN0000239012 AGGAGGAGCTCCGTGACATTT pLKO_005 1482 CDS 100% 13.200 7.920 N Gpr161 n/a
6 TRCN0000239011 AGGAACCCGGCTACACCATTT pLKO_005 754 CDS 100% 10.800 6.480 N Gpr161 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081126.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02766 pDONR223 100% 83.2% 87.8% None (many diffs) n/a
2 ccsbBroad304_02766 pLX_304 0% 83.2% 87.8% V5 (many diffs) n/a
3 TRCN0000471229 GAAGTCACCCTACTTATAAGCTCG pLX_317 26.5% 83.2% 87.8% V5 (many diffs) n/a
4 TRCN0000488861 CGGATCCTCTTTTATTGTACGGTT pLX_317 21.7% 83.2% 87.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487991 GGCATAGCGAACAGCCTCTTCGTC pLX_317 20% 83.1% 87.6% V5 (many diffs) n/a
Download CSV