Transcript: Mouse NM_001310430.1

Mus musculus G protein-coupled receptor 161 (Gpr161), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gpr161 (240888)
Length:
6879
CDS:
232..1818

Additional Resources:

NCBI RefSeq record:
NM_001310430.1
NBCI Gene record:
Gpr161 (240888)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310430.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257039 CCATCCGGAGGGAATGGATTT pLKO_005 491 CDS 100% 10.800 8.640 N Gpr161 n/a
2 TRCN0000239013 CCTTCAAGGAGTGGTCTATTC pLKO_005 993 CDS 100% 10.800 7.560 N Gpr161 n/a
3 TRCN0000239014 TACGCAGCCAGCTTGGCTAAA pLKO_005 1612 CDS 100% 10.800 7.560 N Gpr161 n/a
4 TRCN0000014229 CCTCAGCAACAAGTTCGTCTT pLKO.1 408 CDS 100% 4.050 2.835 N GPR161 n/a
5 TRCN0000239012 AGGAGGAGCTCCGTGACATTT pLKO_005 1507 CDS 100% 13.200 7.920 N Gpr161 n/a
6 TRCN0000239011 AGGAACCCGGCTACACCATTT pLKO_005 779 CDS 100% 10.800 6.480 N Gpr161 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310430.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02766 pDONR223 100% 87.9% 92.8% None (many diffs) n/a
2 ccsbBroad304_02766 pLX_304 0% 87.9% 92.8% V5 (many diffs) n/a
3 TRCN0000471229 GAAGTCACCCTACTTATAAGCTCG pLX_317 26.5% 87.9% 92.8% V5 (many diffs) n/a
4 TRCN0000488861 CGGATCCTCTTTTATTGTACGGTT pLX_317 21.7% 87.9% 92.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487991 GGCATAGCGAACAGCCTCTTCGTC pLX_317 20% 87.8% 92.6% V5 (many diffs) n/a
Download CSV