Construct: ORF TRCN0000488009
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020569.1_s317c1
- DNA Barcode:
- GTTTACTCCTAAGTCTCCATGTCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- FYN (2534)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488009
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_001370529.1 | 100% | 100% | |
| 2 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_002037.5 | 100% | 100% | |
| 3 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010650.1 | 100% | 100% | |
| 4 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010651.1 | 100% | 100% | |
| 5 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010652.1 | 100% | 100% | |
| 6 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010653.1 | 100% | 100% | |
| 7 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_153047.4 | 93.7% | 94.4% | (many diffs) |
| 8 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_153048.3 | 89.7% | 89.7% | 696_697ins165 |
| 9 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_005266892.4 | 89.7% | 89.7% | 696_697ins165 |
| 10 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010655.2 | 56.1% | 53.7% | (many diffs) |
| 11 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_001122893.1 | 93.2% | 99.4% | (many diffs) |
| 12 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_006512539.3 | 93.2% | 99.4% | (many diffs) |
| 13 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_006512540.3 | 93.2% | 99.4% | (many diffs) |
| 14 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_011243117.2 | 93.2% | 99.4% | (many diffs) |
| 15 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_001122892.1 | 87.7% | 93.8% | (many diffs) |
| 16 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_008054.2 | 87.7% | 93.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 84
- ORF end:
- 1695
- ORF length:
- 1611
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggctccgc ggcccccttc accatgggct gtgtgcaatg taaggataaa gaagcaacaa 121 aactgacgga ggagagggac ggcagcctga accagagctc tgggtaccgc tatggcacag 181 accccacccc tcagcactac cccagcttcg gtgtgacctc catccccaac tacaacaact 241 tccacgcagc cgggggccaa ggactcaccg tctttggagg tgtgaactct tcgtctcata 301 cggggacctt gcgtacgaga ggaggaacag gagtgacact ctttgtggcc ctttatgact 361 atgaagcacg gacagaagat gacctgagtt ttcacaaagg agaaaaattt caaatattga 421 acagctcgga aggagattgg tgggaagccc gctccttgac aactggagag acaggttaca 481 ttcccagcaa ttatgtggct ccagttgact ctatccaggc agaagagtgg tactttggaa 541 aacttggccg aaaagatgct gagcgacagc tattgtcctt tggaaaccca agaggtacct 601 ttcttatccg cgagagtgaa accaccaaag gtgcctattc actttctatc cgtgattggg 661 atgatatgaa aggagaccat gtcaaacatt ataaaattcg caaacttgac aatggtggat 721 actacattac cacccgggcc cagtttgaaa cacttcagca gcttgtacaa cattactcag 781 agagagctgc aggtctctgc tgccgcctag tagttccctg tcacaaaggg atgccaaggc 841 ttaccgatct gtctgtcaaa accaaagatg tctgggaaat ccctcgagaa tccctgcagt 901 tgatcaagag actgggaaat gggcagtttg gggaagtatg gatgggtacc tggaatggaa 961 acacaaaagt agccataaag actcttaaac caggcacaat gtcccccgaa tcattccttg 1021 aggaagcgca gatcatgaag aagctgaagc acgacaagct ggtccagctc tatgcagtgg 1081 tgtctgagga gcccatctac atcgtcaccg agtatatgaa caaaggaagt ttactggatt 1141 tcttaaaaga tggagaagga agagctctga aattaccaaa tcttgtggac atggcagcac 1201 aggtggctgc aggaatggct tacatcgagc gcatgaatta tatccataga gatctgcgat 1261 cagcaaacat tctagtgggg aatggactca tatgcaagat tgctgacttc ggattggccc 1321 gattgataga agacaatgag tacacagcaa gacaaggtgc aaagttcccc atcaagtgga 1381 cggcccccGA GGCAGCCCTG TACGGGAGGT TCACAATCAA GTCTGACGTG TGGTCTTTTG 1441 GAATCTTACT CACAGAGCTG GTCACCAAAG GAAGAGTGCC ATACCCAGGC ATGAACAACC 1501 GGGAGGTGCT GGAGCAGGTG GAGCGAGGCT ACAGGATGCC CTGCCCGCAG GACTGCCCCA 1561 TCTCTCTGCA TGAGCTCATG ATCCACTGCT GGAAAAAGGA CCCTGAAGAA CGCCCCACTT 1621 TTGAGTACTT GCAGAGCTTC CTGGAAGACT ACTTTACCGC GACAGAGCCC CAGTACCAAC 1681 CTGGTGAAAA CCTGTAAGGG AATTCAAGGG TGGGCGCGCC GACCCAGCTT TCTTGTACAA 1741 AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA 1801 ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA 1861 GGACGAGTTT ACTCCTAAGT CTCCATGTCG ACGCGTTAAG TCgacaatca acctctggat 1921 tacaaaattt gtgaaagatt