Construct: ORF TRCN0000488039
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020422.1_s317c1
- DNA Barcode:
- GGTTGATAAACGCGGGTAGCTCGT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAPK14 (1432)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488039
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1432 | MAPK14 | mitogen-activated protein k... | NM_139012.2 | 100% | 100% | |
| 2 | human | 1432 | MAPK14 | mitogen-activated protein k... | NM_001315.2 | 94.6% | 96.1% | (many diffs) |
| 3 | human | 1432 | MAPK14 | mitogen-activated protein k... | XM_017010299.2 | 85.5% | 74.6% | (many diffs) |
| 4 | human | 1432 | MAPK14 | mitogen-activated protein k... | NM_139014.2 | 85.2% | 70.4% | 762_763ins79;921_922ins80 |
| 5 | human | 1432 | MAPK14 | mitogen-activated protein k... | XM_011514310.3 | 83.9% | 82.2% | (many diffs) |
| 6 | human | 1432 | MAPK14 | mitogen-activated protein k... | NM_139013.3 | 81.3% | 77.5% | (many diffs) |
| 7 | human | 1432 | MAPK14 | mitogen-activated protein k... | XM_017010300.2 | 80.5% | 70.9% | (many diffs) |
| 8 | human | 1432 | MAPK14 | mitogen-activated protein k... | XM_017010301.2 | 79.8% | 77.3% | (many diffs) |
| 9 | human | 1432 | MAPK14 | mitogen-activated protein k... | XM_006714998.3 | 78.6% | 78.6% | 0_1ins231 |
| 10 | human | 1432 | MAPK14 | mitogen-activated protein k... | XM_017010304.2 | 70.8% | 70.6% | 764_767delATGC;772_773delCCinsAA;774_775ins310 |
| 11 | human | 1432 | MAPK14 | mitogen-activated protein k... | XM_017010302.2 | 68.3% | 61.7% | (many diffs) |
| 12 | human | 1432 | MAPK14 | mitogen-activated protein k... | XM_017010303.2 | 67.3% | 65.2% | (many diffs) |
| 13 | human | 1432 | MAPK14 | mitogen-activated protein k... | XR_926065.2 | 54.5% | (many diffs) | |
| 14 | mouse | 26416 | Mapk14 | mitogen-activated protein k... | NM_011951.3 | 90.2% | 99.4% | (many diffs) |
| 15 | mouse | 26416 | Mapk14 | mitogen-activated protein k... | NM_001168508.1 | 85.5% | 95.5% | (many diffs) |
| 16 | mouse | 26416 | Mapk14 | mitogen-activated protein k... | NM_001168513.1 | 71.5% | 78.3% | (many diffs) |
| 17 | mouse | 26416 | Mapk14 | mitogen-activated protein k... | NM_001168514.1 | 71.5% | 78.3% | (many diffs) |
| 18 | mouse | 26416 | Mapk14 | mitogen-activated protein k... | XM_017317480.1 | 67.1% | 74.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 84
- ORF end:
- 1164
- ORF length:
- 1080
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggctccgc ggcccccttc accatgtctc aggagaggcc cacgttctac cggcaggagc 121 tgaacaagac aatctgggag gtgcccgagc gttaccagaa cctgtctcca gtgggctctg 181 gcgcctatgg ctctgtgtgt gctgcttttg acacaaaaac ggggttacgt gtggcagtga 241 agaagctctc cagaccattt cagtccatca ttcatgcgaa aagaacctac agagaactgc 301 ggttacttaa acatatgaaa catgaaaatg tgattggtct gttggacgtt tttacacctg 361 caaggtctct ggaggaattc aatgatgtgt atctggtgac ccatctcatg ggggcagatc 421 tgaacaacat tgtgaaatgt cagaagctta cagatgacca tgttcagttc cttatctacc 481 aaattctccg aggtctaaag tatatacatt cagctgacat aattcacagg gacctaaaac 541 ctagtaatct agctgtgaat gaagactgtg agctgaagat tctggatttt ggactggctc 601 ggcacacaga tgatgaaatg acaggctacg tggccactag gtggtacagg gctcctgaga 661 tcatgctgaa ctggatgcat tacaaccaga cagttgatat ttggtcagtg ggatgcataa 721 tggccgagct gttgactgga agaacattgt ttcctggtac agaccatatt gatcagttga 781 agctcatttt aagactcgtt ggaaccccag gggctgagct tttgaagaaa atctcctcag 841 agtctgcaag aaactatatt cagtctttga ctcagatgcc gaagatgaac tttgcgaatg 901 tatttattgg tgccaatccc ctggctgtcg acttgctGGA GAAGATGCTT GTATTGGACT 961 CAGATAAGAG AATTACAGCG GCCCAAGCCC TTGCACATGC CTACTTTGCT CAGTACCACG 1021 ATCCTGATGA TGAACCAGTG GCCGATCCTT ATGATCAGTC CTTTGAAAGC AGGGACCTCC 1081 TTATAGATGA GTGGAAAAGC CTGACCTATG ATGAAGTCAT CAGCTTTGTG CCACCACCCC 1141 TTGACCAAGA AGAGATGGAG TCCTGATCTA GAAAGGGTGG GCGCGCCGAC CCAGCTTTCT 1201 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1261 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1321 GTGGAAAGGA CGAGGTTGAT AAACGCGGGT AGCTCGTACG CGTTAAGTCg acaatcaacc 1381 tctggattac aaaatttgtg aaagatt