Transcript: Mouse NM_001168514.1

Mus musculus mitogen-activated protein kinase 14 (Mapk14), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Mapk14 (26416)
Length:
3605
CDS:
675..1526

Additional Resources:

NCBI RefSeq record:
NM_001168514.1
NBCI Gene record:
Mapk14 (26416)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304327 TGACCGGAAGAACGTTGTTTC pLKO_005 1093 CDS 100% 10.800 15.120 N Mapk14 n/a
2 TRCN0000023123 GCTGAATTGGATGCACTATAA pLKO.1 1025 CDS 100% 13.200 10.560 N Mapk14 n/a
3 TRCN0000304365 GCTGAATTGGATGCACTATAA pLKO_005 1025 CDS 100% 13.200 10.560 N Mapk14 n/a
4 TRCN0000304366 GACCGTTTCAGTCCATCATTC pLKO_005 613 5UTR 100% 10.800 8.640 N Mapk14 n/a
5 TRCN0000022995 CCGAAGATGAACTTCGCAAAT pLKO.1 1239 CDS 100% 1.080 0.864 N LOC381082 n/a
6 TRCN0000055227 CGAGGGCTGAAGTATATACAT pLKO.1 849 CDS 100% 5.625 3.938 N Mapk14 n/a
7 TRCN0000055224 CTCAGAGTCTGCAAGAAACTA pLKO.1 1196 CDS 100% 5.625 3.938 N Mapk14 n/a
8 TRCN0000023120 GAGTCTGCAAGAAACTACATT pLKO.1 1200 CDS 100% 5.625 3.938 N Mapk14 n/a
9 TRCN0000023121 AGACCATATTGATCAGTTGAA pLKO.1 1121 CDS 100% 4.950 3.465 N Mapk14 n/a
10 TRCN0000055226 AGAGTCTGCAAGAAACTACAT pLKO.1 1199 CDS 100% 4.950 3.465 N Mapk14 n/a
11 TRCN0000055223 CCAACAATTCTGCTCTGGTTA pLKO.1 3316 3UTR 100% 4.950 3.465 N Mapk14 n/a
12 TRCN0000301582 CCAACAATTCTGCTCTGGTTA pLKO_005 3316 3UTR 100% 4.950 3.465 N Mapk14 n/a
13 TRCN0000022998 CCACGTTCAGTTTCTCATCTA pLKO.1 818 CDS 100% 4.950 3.465 N LOC381082 n/a
14 TRCN0000023122 CCTGACCTATGATGAAGTCAT pLKO.1 1460 CDS 100% 4.950 3.465 N Mapk14 n/a
15 TRCN0000055225 GTCTGCAAGAAACTACATTCA pLKO.1 1202 CDS 100% 4.950 3.465 N Mapk14 n/a
16 TRCN0000023119 CCTCTTGTTGAAAGATTCCTT pLKO.1 1610 3UTR 100% 3.000 2.100 N Mapk14 n/a
17 TRCN0000310885 CCTCTTGTTGAAAGATTCCTT pLKO_005 1610 3UTR 100% 3.000 2.100 N Mapk14 n/a
18 TRCN0000010053 GACATAATTCACAGGGACCTA pLKO.1 876 CDS 100% 2.640 1.848 N MAPK14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00371 pDONR223 100% 71.5% 78.3% None (many diffs) n/a
2 ccsbBroad304_00371 pLX_304 57.5% 71.5% 78.3% V5 (many diffs) n/a
3 ccsbBroadEn_14596 pDONR223 0% 71.5% 78.3% None (many diffs) n/a
4 ccsbBroad304_14596 pLX_304 57.5% 71.5% 78.3% V5 (many diffs) n/a
5 TRCN0000467697 CTGGGCCATGATGAACCTGATATT pLX_317 30.7% 71.5% 78.3% V5 (many diffs) n/a
6 TRCN0000488917 TATCTACGAACTTGGAGCTCCGGG pLX_317 31.3% 71.5% 78.3% V5 (many diffs) n/a
7 TRCN0000489126 CACCAATATGTCTGCCCACCGTGT pLX_317 30.7% 71.5% 78.3% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488039 GGTTGATAAACGCGGGTAGCTCGT pLX_317 22.8% 71.5% 78.3% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000488445 GATCACTGAGCTGGTAGGCGGGCA pLX_317 30.7% 68.3% 46.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV