Transcript: Human NM_001315.2

Homo sapiens mitogen-activated protein kinase 14 (MAPK14), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
MAPK14 (1432)
Length:
4353
CDS:
482..1564

Additional Resources:

NCBI RefSeq record:
NM_001315.2
NBCI Gene record:
MAPK14 (1432)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148584 CAAGGCGAGTAATACCTGTC pXPR_003 TGG 608 56% 7 0.9659 MAPK14 MAPK14 77922
2 BRDN0001487162 AAGTAACCGCAGTTCTCTGT pXPR_003 AGG 208 19% 2 0.8828 MAPK14 MAPK14 77925
3 BRDN0001148417 TGATGAAATGACAGGCTACG pXPR_003 TGG 544 50% 7 -0.0885 MAPK14 MAPK14 77924
4 BRDN0001145809 CACAAAAACGGGGTTACGTG pXPR_003 TGG 145 13% 2 -0.5444 MAPK14 MAPK14 77923
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001315.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000512 CGAGGTCTAAAGTATATACAT pLKO.1 887 CDS 100% 5.625 7.875 N MAPK14 n/a
2 TRCN0000000509 GCCGTATAGGATGTCAGACAA pLKO.1 3819 3UTR 100% 4.950 6.930 N MAPK14 n/a
3 TRCN0000010051 GTTACGTGTGGCAGTGAAGAA pLKO.1 622 CDS 100% 4.950 6.930 N MAPK14 n/a
4 TRCN0000196320 GCGGTTACTTAAACATATGAA pLKO.1 697 CDS 100% 0.000 0.000 N MAPK14 n/a
5 TRCN0000194849 CTTCGGTTTCTGAGCATAATG pLKO.1 3702 3UTR 100% 13.200 10.560 N MAPK14 n/a
6 TRCN0000000511 CCATGAGGCAAGAAACTATAT pLKO.1 1237 CDS 100% 13.200 9.240 N MAPK14 n/a
7 TRCN0000196472 GTACTTCCTGTGTACTCTTTA pLKO.1 2452 3UTR 100% 13.200 9.240 N MAPK14 n/a
8 TRCN0000000510 CCATGTTCAGTTCCTTATCTA pLKO.1 856 CDS 100% 5.625 3.938 N MAPK14 n/a
9 TRCN0000000513 CCATTTCAGTCCATCATTCAT pLKO.1 653 CDS 100% 5.625 3.938 N MAPK14 n/a
10 TRCN0000010054 CTCGGCACACAGATGATGAAA pLKO.1 996 CDS 100% 5.625 3.938 N MAPK14 n/a
11 TRCN0000194820 CCTAGTAATCTAGCTGTGAAT pLKO.1 938 CDS 100% 4.950 3.465 N MAPK14 n/a
12 TRCN0000023122 CCTGACCTATGATGAAGTCAT pLKO.1 1498 CDS 100% 4.950 3.465 N Mapk14 n/a
13 TRCN0000010052 GTTCAGTTCCTTATCTACCAA pLKO.1 860 CDS 100% 3.000 2.100 N MAPK14 n/a
14 TRCN0000022997 ACAGACCATATTAACCAGCTT pLKO.1 1157 CDS 100% 2.640 1.848 N LOC381082 n/a
15 TRCN0000010053 GACATAATTCACAGGGACCTA pLKO.1 914 CDS 100% 2.640 1.848 N MAPK14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001315.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488445 GATCACTGAGCTGGTAGGCGGGCA pLX_317 30.7% 99.4% 70.9% V5 (not translated due to prior stop codon) 760G>C;762_763insAGTCT n/a
2 ccsbBroadEn_00371 pDONR223 100% 94.6% 96.1% None (many diffs) n/a
3 ccsbBroad304_00371 pLX_304 57.5% 94.6% 96.1% V5 (many diffs) n/a
4 ccsbBroadEn_14596 pDONR223 0% 94.6% 96.1% None (many diffs) n/a
5 ccsbBroad304_14596 pLX_304 57.5% 94.6% 96.1% V5 (many diffs) n/a
6 TRCN0000467697 CTGGGCCATGATGAACCTGATATT pLX_317 30.7% 94.6% 96.1% V5 (many diffs) n/a
7 TRCN0000488917 TATCTACGAACTTGGAGCTCCGGG pLX_317 31.3% 94.6% 96.1% V5 (many diffs) n/a
8 TRCN0000489126 CACCAATATGTCTGCCCACCGTGT pLX_317 30.7% 94.6% 96.1% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000488039 GGTTGATAAACGCGGGTAGCTCGT pLX_317 22.8% 94.6% 96.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV