Construct: ORF TRCN0000488056
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019229.1_s317c1
- DNA Barcode:
- CACGACTAATCCAGAACAAGACAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OPCML (4978)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488056
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4978 | OPCML | opioid binding protein/cell... | NM_002545.4 | 100% | 100% | |
2 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319106.1 | 99.7% | 99.7% | 525_526insGAA |
3 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319103.1 | 97.4% | 97.4% | 937_963del |
4 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001012393.3 | 95% | 93.3% | (many diffs) |
5 | human | 4978 | OPCML | opioid binding protein/cell... | XM_006718846.3 | 94.7% | 93% | (many diffs) |
6 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319105.1 | 88.1% | 88.1% | 0_1ins123 |
7 | human | 4978 | OPCML | opioid binding protein/cell... | XM_011542856.3 | 88.1% | 88.1% | 0_1ins123 |
8 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319104.2 | 71% | 71% | 0_1ins300 |
9 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510437.3 | 92% | 98.5% | (many diffs) |
10 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510438.3 | 91.7% | 98.2% | (many diffs) |
11 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510434.3 | 89.7% | 96% | (many diffs) |
12 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510435.3 | 89.4% | 95.7% | (many diffs) |
13 | mouse | 330908 | Opcml | opioid binding protein/cell... | NM_177906.4 | 86.9% | 91.5% | (many diffs) |
14 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_011242559.2 | 85% | 89.5% | (many diffs) |
15 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510439.3 | 78.4% | 84.4% | (many diffs) |
16 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510440.2 | 62.9% | 67.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1110
- ORF length:
- 1035
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgggg gtctgtgggt acctgttcct gccctggaag tgcctcgtgg 121 tcgtgtctct caggctgctg ttccttgtac ccacaggagt gcccgtgcgc agcggagatg 181 ccaccttccc caaagctatg gacaacgtga cggtccggca gggggagagc gccaccctca 241 ggtgtaccat agatgaccgg gtaacccggg tggcctggct aaaccgcagc accatcctct 301 acgctgggaa tgacaagtgg tccatagacc ctcgtgtgat catcctggtc aatacaccaa 361 cccagtacag catcatgatc caaaatgtgg atgtgtatga cgaaggtccg tacacctgct 421 ctgtgcagac agacaatcat cccaaaacgt cccgggttca cctaatagtg caagttcctc 481 ctcagatcat gaatatctcc tcagacatca ctgtgaatga gggaagcagt gtgaccctgc 541 tgtgtcttgc tattggcaga ccagagccaa ctgtgacatg gagacacctg tcagtcaagg 601 aaggccaggg ctttgtaagt gaggatgagt acctggagat ctctgacatc aagcgagacc 661 agtccgggga gtacgaatgc agcgcgttga acgatgtcgc tgcgcccgat gtgcggaaag 721 taaaaatcac tgtaaactat cctccctata tctcaaaagc caagaacact ggtgtttcag 781 tcggtcagaa gggcatccTG AGCTGTGAAG CCTCTGCAGT CCCCATGGCT GAATTCCAGT 841 GGTTCAAGGA AGAAACCAGG TTAGCCACTG GTCTGGATGG AATGAGGATT GAAAACAAAG 901 GCCGCATGTC CACTCTGACT TTCTTCAATG TTTCAGAAAA GGATTATGGG AACTATACTT 961 GTGTGGCCAC GAACAAGCTT GGGAACACCA ATGCCAGCAT CACATTGTAT GGGCCTGGAG 1021 CAGTCATTGA TGGTGTAAAC TCGGCCTCCA GAGCACTGGC TTGTCTCTGG CTATCAGGGA 1081 CCCTCTTAGC CCACTTCTTC ATCAAGTTTG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 1141 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1201 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACACGA 1261 CTAATCCAGA ACAAGACACA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1321 tgaaagatt