Construct: ORF TRCN0000488343
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021812.1_s317c1
- DNA Barcode:
- CTATAAAAACTCAAGTCCGGTCCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- KRAS (3845)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488343
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3845 | KRAS | KRAS proto-oncogene, GTPase | NM_001369787.1 | 100% | 100% | |
| 2 | human | 3845 | KRAS | KRAS proto-oncogene, GTPase | NM_004985.5 | 100% | 100% | |
| 3 | human | 3845 | KRAS | KRAS proto-oncogene, GTPase | NM_001369786.1 | 90.5% | 89.9% | (many diffs) |
| 4 | human | 3845 | KRAS | KRAS proto-oncogene, GTPase | NM_033360.4 | 90.5% | 89.9% | (many diffs) |
| 5 | mouse | 16653 | Kras | Kirsten rat sarcoma viral o... | NM_021284.6 | 93.6% | 97.3% | (many diffs) |
| 6 | mouse | 16653 | Kras | Kirsten rat sarcoma viral o... | XM_006506918.3 | 86.5% | 89.9% | (many diffs) |
| 7 | mouse | 16653 | Kras | Kirsten rat sarcoma viral o... | XM_006506919.3 | 77.5% | 80.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 102
- ORF end:
- 666
- ORF length:
- 564
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggctccgc ggccgccccc ttcaccggat ccctgctgaa aatgactgaa tataaacttg 121 tggtagttgg agctggtggc gtaggcaaga gtgccttgac gatacagcta attcagaatc 181 attttgtgga cgaatatgat ccaacaatag aggattccta caggaagcaa gtagtaattg 241 atggagaaac ctgtctcttg gatattctcg acacagcagg tcaagaggag tacagtgcaa 301 tgagggacca gtacatgagg actggggagg gctttctttg tgtattTGCC ATAAATAATA 361 CTAAATCATT TGAAGATATT CACCATTATA GAGAACAAAT TAAAAGAGTT AAGGACTCTG 421 AAGATGTACC TATGGTCCTA GTAGGAAATA AATGTGATTT GCCTTCTAGA ACAGTAGACA 481 CAAAACAGGC TCAGGACTTA GCAAGAAGTT ATGGAATTCC TTTTATTGAA ACATCAGCAA 541 AGACAAGACA GGGTGTTGAT GATGCCTTCT ATACATTAGT TCGAGAAATT CGAAAACATA 601 AAGAAAAGAT GAGCAAAGAT GGTAAAAAGA AGAAAAAGAA GTCAAAGACA AAGTGTGTAA 661 TTATGTAAAA GCTTAAGGGT GGGCGCGCCG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 721 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 781 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACTATA 841 AAAACTCAAG TCCGGTCCCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 901 tgaaagatt