Construct: ORF TRCN0000488347
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021194.1_s317c1
- DNA Barcode:
- AGTGCCATTTAGCATCCTCTTTTT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- OPCML (4978)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488347
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4978 | OPCML | opioid binding protein/cell... | NM_002545.4 | 100% | 100% | |
| 2 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319106.1 | 99.7% | 99.7% | 525_526insGAA |
| 3 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319103.1 | 97.4% | 97.4% | 937_963del |
| 4 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001012393.3 | 95% | 93.3% | (many diffs) |
| 5 | human | 4978 | OPCML | opioid binding protein/cell... | XM_006718846.3 | 94.7% | 93% | (many diffs) |
| 6 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319105.1 | 88.1% | 88.1% | 0_1ins123 |
| 7 | human | 4978 | OPCML | opioid binding protein/cell... | XM_011542856.3 | 88.1% | 88.1% | 0_1ins123 |
| 8 | human | 4978 | OPCML | opioid binding protein/cell... | NM_001319104.2 | 71% | 71% | 0_1ins300 |
| 9 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510437.3 | 92% | 98.5% | (many diffs) |
| 10 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510438.3 | 91.7% | 98.2% | (many diffs) |
| 11 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510434.3 | 89.7% | 96% | (many diffs) |
| 12 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510435.3 | 89.4% | 95.7% | (many diffs) |
| 13 | mouse | 330908 | Opcml | opioid binding protein/cell... | NM_177906.4 | 86.9% | 91.5% | (many diffs) |
| 14 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_011242559.2 | 85% | 89.5% | (many diffs) |
| 15 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510439.3 | 78.4% | 84.4% | (many diffs) |
| 16 | mouse | 330908 | Opcml | opioid binding protein/cell... | XM_006510440.2 | 62.9% | 67.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1107
- ORF length:
- 1035
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggggtc tgtgggtacc tgttcctgcc ctggaagtgc ctcgtggtcg 121 tgtctctcag gctgctgttc cttgtaccca caggagtgcc cgtgcgcagc ggagatgcca 181 ccttccccaa agctatggac aacgtgacgg tccggcaggg ggagagcgcc accctcaggt 241 gtaccataga tgaccgggta acccgggtgg cctggctaaa ccgcagcacc atcctctacg 301 ctgggaatga caagtggtcc atagaccctc gtgtgatcat cctggtcaat acaccaaccc 361 agtacagcat catgatccaa aatgtggatg tgtatgacga aggtccgtac acctgctctg 421 tgcagacaga caatcatccc aaaacgtccc gggttcacct aatagtgcaa gttcctcctc 481 agatcatgaa tatctcctca gacatcactg tgaatgaggg aagcagtgtg accctgctgt 541 gtcttgctat tggcagacca gagccaactg tgacatggag acacctgtca gtcaaggaag 601 gccagggctt tgtaagtgag gatgagtacc tggagatctc tgacatcaag cgagaccagt 661 ccggggagta cgaatgcagc gcgttgaacg atgtcgctgc gcccgatgtg cggaaagtaa 721 aaatcactgt aaactatcct ccctatatct caaaagccaa gaacactggt gtttcagtcg 781 gtcagaaggg catccTGAGC TGTGAAGCCT CTGCAGTCCC CATGGCTGAA TTCCAGTGGT 841 TCAAGGAAGA AACCAGGTTA GCCACTGGTC TGGATGGAAT GAGGATTGAA AACAAAGGCC 901 GCATGTCCAC TCTGACTTTC TTCAATGTTT CAGAAAAGGA TTATGGGAAC TATACTTGTG 961 TGGCCACGAA CAAGCTTGGG AACACCAATG CCAGCATCAC ATTGTATGGG CCTGGAGCAG 1021 TCATTGATGG TGTAAACTCG GCCTCCAGAG CACTGGCTTG TCTCTGGCTA TCAGGGACCC 1081 TCTTAGCCCA CTTCTTCATC AAGTTTTGAG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 1141 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1201 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAAGTGC 1261 CATTTAGCAT CCTCTTTTTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1321 tgaaagatt