Construct: ORF TRCN0000488438
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020224.1_s317c1
- DNA Barcode:
- TGGGCAGAAAGGATGCTTCTAAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CDK18 (5129)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488438
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5129 | CDK18 | cyclin dependent kinase 18 | NM_002596.4 | 99.5% | 99.3% | 1_6delATGATC;497C>T |
| 2 | human | 5129 | CDK18 | cyclin dependent kinase 18 | NM_212502.3 | 99.5% | 99.3% | 1_6delATGATC;497C>T |
| 3 | human | 5129 | CDK18 | cyclin dependent kinase 18 | NM_212503.3 | 93.5% | 93.4% | 1_6delATGATC;274_363del;587C>T |
| 4 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XM_011509602.3 | 87% | 86.9% | 1_210del;701C>T |
| 5 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XM_017001423.2 | 82.4% | 82.3% | 1_210del;478_567del;791C>T |
| 6 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_002956776.1 | 38.6% | (many diffs) | |
| 7 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_426781.4 | 38.1% | (many diffs) | |
| 8 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_426784.3 | 37.9% | (many diffs) | |
| 9 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_426782.4 | 37.6% | (many diffs) | |
| 10 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_001737213.1 | 36.8% | (many diffs) | |
| 11 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_426780.4 | 36.7% | (many diffs) | |
| 12 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_426779.3 | 35.9% | (many diffs) | |
| 13 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_921822.3 | 35.8% | (many diffs) | |
| 14 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_001737212.2 | 35% | (many diffs) | |
| 15 | mouse | 18557 | Cdk18 | cyclin-dependent kinase 18 | NM_008795.2 | 85.2% | 87% | (many diffs) |
| 16 | mouse | 18557 | Cdk18 | cyclin-dependent kinase 18 | XM_011247940.2 | 71.5% | 73.7% | (many diffs) |
| 17 | mouse | 18557 | Cdk18 | cyclin-dependent kinase 18 | XR_001783189.1 | 35.6% | (many diffs) | |
| 18 | mouse | 18557 | Cdk18 | cyclin-dependent kinase 18 | XR_387152.3 | 33.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1488
- ORF length:
- 1416
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaacaag atgaagaact ttaagcgccg tttctccctg tcagtgcccc 121 gcactgagac cattgaagaa tccttggctg aattcacgga gcaattcaac cagctccaca 181 accggcggaa tgagaacttg cagctcggtc ctcttggcag agaccccccg caggagtgca 241 gcaccttctc cccaacagac agcggggagg agccggggca gctctcccct ggcgtgcagt 301 tccagcggcg gcagaaccag cgccgcttct ccatggagga cgtcagcaag aggctctctc 361 tgcccatgga tatccgcctg ccccaggaat tcctacagaa gctacagatg gagagcccag 421 atctgcccaa gccgctcagc cgcatgtccc gccgggcctc cctgtcagac attggctttg 481 ggaaactgga aacatacgtg aaactggaca aactgggaga gggcacctat gccacagtct 541 tcaaagggcg cagcaaactg atggagaacc ttgtggccct gaaagagatc cggctggagc 601 acgaggaggg agcgccctgc actgccatcc gagaggtgtc tctgctgaag aacctgaagc 661 acgccaatat tgtgaccctg catgacctca tccacacaga tcggtccctc accctggtgt 721 ttgagtacct ggacagtgac ctgaagcagt atctggacca ctgtgggaac ctcatgagca 781 tgcacaacgt caagattttc atgttccagc tgctccgggg cctcgcctac tgtcaccacc 841 gcaagatcct gcaccgggac ctgaagcccc agaacctgct catcaacgag aggggggagc 901 tgaagctggc cgactttgga ctggccaggg ccaagtcagt gcccacaaag acttactcca 961 atgaggtggt gaccctgtgg tacaggcccc ccgatgtgct gctgggatcc acagagtact 1021 ccacccccat tgatatgtgg ggcgtgggct gcatccacta cgagatggcc acagggaggc 1081 ccctcttccc gggctccaca gtcaaggagg agctgcacct catctttcgc ctcctcggga 1141 cccccacaga agagacgtgg cccggcgtga ccgccTTCTC TGAGTTCCGC ACCTACAGCT 1201 TCCCCTGCTA CCTCCCGCAG CCGCTCATCA ACCACGCGCC CAGGTTGGAT ACGGATGGCA 1261 TCCACCTCCT GAGCAGCCTG CTCCTGTATG AATCCAAGAG TCGCATGTCA GCAGAGGCTG 1321 CCCTGAGTCA CTCCTACTTC CGGTCTCTGG GAGAGCGTGT GCACCAGCTT GAAGACACTG 1381 CCTCCATCTT CTCCCTGAAG GAGATCCAGC TCCAGAAGGA CCCAGGCTAC CGAGGCTTGG 1441 CCTTCCAGCA GCCAGGACGA GGGAAGAACA GGCGGCAGAG CATCTTCTGA GACCCAGCTT 1501 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1561 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1621 CTTGTGGAAA GGACGATGGG CAGAAAGGAT GCTTCTAAAC ACGCGTTAAG TCgacaatca 1681 acctctggat tacaaaattt gtgaaagatt