Construct: ORF TRCN0000488598
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021437.1_s317c1
- DNA Barcode:
- GTAAACAACTCACACCTAAAGTCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PPP2CB (5516)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488598
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5516 | PPP2CB | protein phosphatase 2 catal... | NM_001009552.2 | 99.3% | 100% | 927_928insTAAGCT |
| 2 | human | 5515 | PPP2CA | protein phosphatase 2 catal... | NM_002715.4 | 82.6% | 97.4% | (many diffs) |
| 3 | human | 5515 | PPP2CA | protein phosphatase 2 catal... | NM_001355019.1 | 64.6% | 78.6% | (many diffs) |
| 4 | mouse | 19053 | Ppp2cb | protein phosphatase 2 (form... | NM_017374.3 | 91.5% | 100% | (many diffs) |
| 5 | mouse | 19052 | Ppp2ca | protein phosphatase 2 (form... | NM_019411.4 | 80.3% | 97.4% | (many diffs) |
| 6 | mouse | 19053 | Ppp2cb | protein phosphatase 2 (form... | XM_006509033.1 | 71.7% | 78.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 90
- ORF end:
- 1017
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaatccg 61 cggccgcccc cttcaccgga tccgccgcca tggacgacaa ggcgttcacc aaggagctgg 121 accagtgggt cgagcagctg aacgagtgta agcagctgaa cgagaaccaa gtgcggacgc 181 tgtgcgagaa ggcaaaggaa attttaacaa aagaatcaaa tgtgcaagag gttcgttgcc 241 ctgttactgt ctgtggagat gtgcatggtc aatttcatga tcttatggaa ctctttagaa 301 ttggtggaaa atcaccggat acaaactact tattcatggg tgactatgta gacagaggat 361 attattcagt ggagactgtg actcttcttg tagcattaaa ggtgcgttat ccagaacgca 421 ttacaatatt gagaggaaat cacgaaagcc gacaaattac ccaagtatat ggcttttatg 481 atgaatgtct gcgaaagtat gggaatgcca acgtttggaa atattttaca gatctctttg 541 attatcttcc acttacagct ttagtagatg gacagatatt ctgcctccat ggtggcctct 601 ctccatccat agacacactg gatcatataa gagccctgga tcgtttacag gaagttccac 661 atgagggCCC AATGTGTGAT CTGTTATGGT CAGATCCAGA TGATCGTGGT GGATGGGGTA 721 TTTCACCACG TGGTGCTGGC TACACATTTG GACAAGACAT TTCTGAAACC TTTAACCATG 781 CCAATGGTCT CACACTGGTT TCTCGTGCCC ACCAGCTTGT AATGGAGGGA TACAATTGGT 841 GTCATGATCG GAATGTGGTT ACCATTTTCA GTGCACCCAA TTACTGTTAT CGTTGTGGGA 901 ACCAGGCTGC TATCATGGAA TTAGATGACA CTTTAAAATA TTCCTTCCTT CAATTTGACC 961 CAGCGCCTCG TCGTGGTGAG CCTCATGTTA CACGGCGCAC CCCAGACTAC TTCCTATAAG 1021 CTTAAGGGTG GGCGCGCCGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT 1081 ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA 1141 AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGTAAAC AACTCACACC 1201 TAAAGTCCAC GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt