Transcript: Mouse XM_006509033.1

PREDICTED: Mus musculus protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform (Ppp2cb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp2cb (19053)
Length:
1620
CDS:
277..1011

Additional Resources:

NCBI RefSeq record:
XM_006509033.1
NBCI Gene record:
Ppp2cb (19053)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012414 CGGCAGATCACACAAGTGTAT pLKO.1 442 CDS 100% 4.950 6.930 N Ppp2cb n/a
2 TRCN0000294579 CGGCAGATCACACAAGTGTAT pLKO_005 442 CDS 100% 4.950 6.930 N Ppp2cb n/a
3 TRCN0000012417 GCCCAATGTGTGATCTCTTAT pLKO.1 659 CDS 100% 13.200 9.240 N Ppp2cb n/a
4 TRCN0000294513 GCCCAATGTGTGATCTCTTAT pLKO_005 659 CDS 100% 13.200 9.240 N Ppp2cb n/a
5 TRCN0000012415 GCTGCTATCATGGAATTAGAT pLKO.1 898 CDS 100% 5.625 3.938 N Ppp2cb n/a
6 TRCN0000002504 GCTTTAGTAGATGGACAGATA pLKO.1 550 CDS 100% 4.950 3.465 N PPP2CB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01262 pDONR223 100% 72.1% 78.9% None (many diffs) n/a
2 ccsbBroad304_01262 pLX_304 0% 72.1% 78.9% V5 (many diffs) n/a
3 TRCN0000472494 TCCGTGTTGCGGATAGAGAATCTT pLX_317 48.3% 72.1% 78.9% V5 (many diffs) n/a
4 TRCN0000488986 AAGAGGAGCAGGTAGGGGCTAGTG pLX_317 32.9% 72.1% 78.9% V5 (many diffs) n/a
5 TRCN0000488598 GTAAACAACTCACACCTAAAGTCC pLX_317 38.4% 71.7% 78.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489912 GGACAAGAAATCAACTTGTATCGC pLX_317 40.1% 64.2% 78.6% V5 (many diffs) n/a
7 TRCN0000489841 CCTCCTTCCTTGGGTTCTATCTTC pLX_317 44.8% 63.8% 78.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV