Construct: ORF TRCN0000488608
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020396.1_s317c1
- DNA Barcode:
- CCACTCAATGCCCTAATGCTGCCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PCMT1 (5110)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488608
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5110 | PCMT1 | protein-L-isoaspartate (D-a... | NM_001360452.1 | 99.8% | 99.5% | 358G>A |
| 2 | human | 5110 | PCMT1 | protein-L-isoaspartate (D-a... | NM_001360456.1 | 98.6% | 98.2% | (many diffs) |
| 3 | human | 5110 | PCMT1 | protein-L-isoaspartate (D-a... | XM_024446451.1 | 94% | 91.7% | (many diffs) |
| 4 | human | 5110 | PCMT1 | protein-L-isoaspartate (D-a... | XM_011535868.2 | 92.9% | 90.4% | (many diffs) |
| 5 | human | 5110 | PCMT1 | protein-L-isoaspartate (D-a... | NM_001252053.1 | 79.5% | 79.2% | 1_174del;532G>A |
| 6 | human | 5110 | PCMT1 | protein-L-isoaspartate (D-a... | NM_005389.2 | 79.5% | 79.2% | 1_174del;532G>A |
| 7 | human | 5110 | PCMT1 | protein-L-isoaspartate (D-a... | NM_001252049.1 | 78.7% | 78.3% | (many diffs) |
| 8 | human | 5110 | PCMT1 | protein-L-isoaspartate (D-a... | NM_001252050.1 | 67.2% | 67% | 1_174del;363_364ins105;427G>A |
| 9 | human | 5110 | PCMT1 | protein-L-isoaspartate (D-a... | NM_001252051.1 | 67.2% | 66.6% | 1_174del;229_230ins105;427G>A |
| 10 | human | 5110 | PCMT1 | protein-L-isoaspartate (D-a... | NM_001252052.1 | 66.5% | 66% | (many diffs) |
| 11 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_017313833.1 | 83.1% | 88.1% | (many diffs) |
| 12 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_017313832.1 | 82.1% | 86.8% | (many diffs) |
| 13 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_017313834.1 | 77.3% | 82.8% | (many diffs) |
| 14 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_017313835.1 | 77.3% | 82.8% | (many diffs) |
| 15 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_006512594.2 | 76.3% | 81.5% | (many diffs) |
| 16 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_011243140.1 | 76.3% | 81.5% | (many diffs) |
| 17 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_011243141.2 | 76.3% | 81.5% | (many diffs) |
| 18 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | NM_008786.2 | 72.2% | 76.8% | (many diffs) |
| 19 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | NM_001347228.1 | 71.5% | 75.8% | (many diffs) |
| 20 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_017313837.1 | 64.3% | 69.1% | (many diffs) |
| 21 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_006512595.3 | 63.4% | 67.9% | (many diffs) |
| 22 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_017313836.1 | 63.4% | 67.9% | (many diffs) |
| 23 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_006512589.3 | 59.3% | 57.3% | (many diffs) |
| 24 | mouse | 18537 | Pcmt1 | protein-L-isoaspartate (D-a... | XM_006512590.2 | 53.3% | 56.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 753
- ORF length:
- 681
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcctgg aaatccggcg gcgccagcca ctcggagcta atccacaatc 121 tccgcaaaaa tggaatcatc aagacagata aagtatttga agtgatgctg gctacagacc 181 gctcccacta tgcaaaatgt aacccataca tggattctcc acaatcaata ggtttccaag 241 caacaatcag tgctccacac atgcatgcat atgcgctaga acttctattt gatcagttgc 301 atgaaggagc taaagctctt gatgtaggat ctggaagtgg aatccttact gcatgttttg 361 cacgtatggt tggatgtact ggaaaagtca taggaattga tcacattaaa gagctagtag 421 atgactcaat aaataatgtc aggaaggacg atccaaCACT TCTGTCTTCA GGGAGAGTAC 481 AGCTTGTTGT GGGGGATGGA AGAATGGGAT ATGCTGAAGA AGCCCCTTAT GATGCCATTC 541 ATGTGGGAGC TGCAGCCCCT GTTGTACCCC AGGCGCTAAT AGATCAGTTA AAGCCCGGAG 601 GAAGATTGAT ATTGCCTGTT GGTCCTGCAG GCGGAAACCA AATGTTGGAG CAGTATGACA 661 AGCTACAAGA TGGCAGCATC AAAATGAAGC CTCTGATGGG GGTGATATAC GTGCCTTTAA 721 CAGATAAAGA AAAGCAGTGG TCCAGGTGGA AGTAGGACCC AGCTTTCTTG TACAAAGTGG 781 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 841 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 901 ACCACTCAAT GCCCTAATGC TGCCTACGCG TTAAGTCgac aatcaacctc tggattacaa 961 aatttgtgaa agatt