Transcript: Mouse XM_017313836.1

PREDICTED: Mus musculus protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 (Pcmt1), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcmt1 (18537)
Length:
2866
CDS:
785..1282

Additional Resources:

NCBI RefSeq record:
XM_017313836.1
NBCI Gene record:
Pcmt1 (18537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313836.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348330 ATACGTGCCTTTAACAGATAA pLKO_005 1231 CDS 100% 13.200 18.480 N Pcmt1 n/a
2 TRCN0000097399 CGTGAGCTTGACCAGTCTATA pLKO.1 1289 3UTR 100% 13.200 18.480 N Pcmt1 n/a
3 TRCN0000097401 CCTCCGCAAGAATGGAATCAT pLKO.1 446 5UTR 100% 5.625 7.875 N Pcmt1 n/a
4 TRCN0000348259 ACATGCCCACATTTCACTTTA pLKO_005 1503 3UTR 100% 13.200 10.560 N Pcmt1 n/a
5 TRCN0000097400 GCCTGGTGGAAGATTGATATT pLKO.1 1117 CDS 100% 13.200 9.240 N Pcmt1 n/a
6 TRCN0000334570 GCCTGGTGGAAGATTGATATT pLKO_005 1117 CDS 100% 13.200 9.240 N Pcmt1 n/a
7 TRCN0000036403 CAGTATGACAAGCTACAAGAT pLKO.1 1175 CDS 100% 4.950 3.465 N PCMT1 n/a
8 TRCN0000300948 CAGTATGACAAGCTACAAGAT pLKO_005 1175 CDS 100% 4.950 3.465 N PCMT1 n/a
9 TRCN0000097403 GAGCAGTATGACAAGCTACAA pLKO.1 1172 CDS 100% 4.950 3.465 N Pcmt1 n/a
10 TRCN0000334571 GAGCAGTATGACAAGCTACAA pLKO_005 1172 CDS 100% 4.950 3.465 N Pcmt1 n/a
11 TRCN0000097402 CCTTACATGGATTCTCCACAA pLKO.1 531 5UTR 100% 4.050 2.835 N Pcmt1 n/a
12 TRCN0000334491 CCTTACATGGATTCTCCACAA pLKO_005 531 5UTR 100% 4.050 2.835 N Pcmt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313836.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11021 pDONR223 100% 64.1% 68.8% None (many diffs) n/a
2 ccsbBroad304_11021 pLX_304 0% 64.1% 68.8% V5 (many diffs) n/a
3 TRCN0000480970 ACGACCGTAACAGTGTGTCGCAGA pLX_317 56.1% 64.1% 68.8% V5 (many diffs) n/a
4 TRCN0000491746 CCAAATTATCATACTCATACACAT pLX_317 55.4% 63.5% 67.8% V5 (many diffs) n/a
5 TRCN0000488608 CCACTCAATGCCCTAATGCTGCCT pLX_317 43.6% 63.4% 67.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV