Transcript: Human NM_001252053.1

Homo sapiens protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCMT1 (5110)
Length:
1065
CDS:
34..891

Additional Resources:

NCBI RefSeq record:
NM_001252053.1
NBCI Gene record:
PCMT1 (5110)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001252053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036403 CAGTATGACAAGCTACAAGAT pLKO.1 787 CDS 100% 4.950 6.930 N PCMT1 n/a
2 TRCN0000300948 CAGTATGACAAGCTACAAGAT pLKO_005 787 CDS 100% 4.950 6.930 N PCMT1 n/a
3 TRCN0000310831 AGCCCGGAGGAAGATTGATAT pLKO_005 728 CDS 100% 13.200 9.240 N PCMT1 n/a
4 TRCN0000036400 GCGCTAGAACTTCTATTTGAT pLKO.1 409 CDS 100% 5.625 3.938 N PCMT1 n/a
5 TRCN0000300887 GCGCTAGAACTTCTATTTGAT pLKO_005 409 CDS 100% 5.625 3.938 N PCMT1 n/a
6 TRCN0000036399 CCAGGCGCTAATAGATCAGTT pLKO.1 705 CDS 100% 4.950 3.465 N PCMT1 n/a
7 TRCN0000097403 GAGCAGTATGACAAGCTACAA pLKO.1 784 CDS 100% 4.950 3.465 N Pcmt1 n/a
8 TRCN0000334571 GAGCAGTATGACAAGCTACAA pLKO_005 784 CDS 100% 4.950 3.465 N Pcmt1 n/a
9 TRCN0000036401 GATCACATTAAAGAGCTAGTA pLKO.1 535 CDS 100% 4.950 3.465 N PCMT1 n/a
10 TRCN0000331688 GATCACATTAAAGAGCTAGTA pLKO_005 535 CDS 100% 4.950 3.465 N PCMT1 n/a
11 TRCN0000036402 CCACAATCAATAGGTTTCCAA pLKO.1 355 CDS 100% 3.000 2.100 N PCMT1 n/a
12 TRCN0000348330 ATACGTGCCTTTAACAGATAA pLKO_005 843 CDS 100% 13.200 7.920 N Pcmt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488608 CCACTCAATGCCCTAATGCTGCCT pLX_317 43.6% 79.5% 79.2% V5 (not translated due to prior stop codon) 1_174del;532G>A n/a
2 TRCN0000491746 CCAAATTATCATACTCATACACAT pLX_317 55.4% 79.3% 79% V5 (many diffs) n/a
3 ccsbBroadEn_11021 pDONR223 100% 78.8% 78.6% None (many diffs) n/a
4 ccsbBroad304_11021 pLX_304 0% 78.8% 78.6% V5 (many diffs) n/a
5 TRCN0000480970 ACGACCGTAACAGTGTGTCGCAGA pLX_317 56.1% 78.8% 78.6% V5 (many diffs) n/a
Download CSV