Transcript: Mouse XM_006512589.3

PREDICTED: Mus musculus protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 (Pcmt1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcmt1 (18537)
Length:
1853
CDS:
412..1173

Additional Resources:

NCBI RefSeq record:
XM_006512589.3
NBCI Gene record:
Pcmt1 (18537)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097401 CCTCCGCAAGAATGGAATCAT pLKO.1 633 CDS 100% 5.625 7.875 N Pcmt1 n/a
2 TRCN0000097402 CCTTACATGGATTCTCCACAA pLKO.1 718 CDS 100% 4.050 2.835 N Pcmt1 n/a
3 TRCN0000334491 CCTTACATGGATTCTCCACAA pLKO_005 718 CDS 100% 4.050 2.835 N Pcmt1 n/a
4 TRCN0000036402 CCACAATCAATAGGTTTCCAA pLKO.1 733 CDS 100% 3.000 4.200 N PCMT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488608 CCACTCAATGCCCTAATGCTGCCT pLX_317 43.6% 59.3% 57.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491746 CCAAATTATCATACTCATACACAT pLX_317 55.4% 59.1% 57.1% V5 (many diffs) n/a
3 ccsbBroadEn_11021 pDONR223 100% 58.9% 56.7% None (many diffs) n/a
4 ccsbBroad304_11021 pLX_304 0% 58.9% 56.7% V5 (many diffs) n/a
5 TRCN0000480970 ACGACCGTAACAGTGTGTCGCAGA pLX_317 56.1% 58.9% 56.7% V5 (many diffs) n/a
Download CSV