Transcript: Mouse NM_001347228.1

Mus musculus protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 (Pcmt1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pcmt1 (18537)
Length:
4283
CDS:
306..1166

Additional Resources:

NCBI RefSeq record:
NM_001347228.1
NBCI Gene record:
Pcmt1 (18537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347228.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348330 ATACGTGCCTTTAACAGATAA pLKO_005 1115 CDS 100% 13.200 18.480 N Pcmt1 n/a
2 TRCN0000097399 CGTGAGCTTGACCAGTCTATA pLKO.1 1173 3UTR 100% 13.200 18.480 N Pcmt1 n/a
3 TRCN0000097401 CCTCCGCAAGAATGGAATCAT pLKO.1 527 CDS 100% 5.625 7.875 N Pcmt1 n/a
4 TRCN0000348259 ACATGCCCACATTTCACTTTA pLKO_005 1387 3UTR 100% 13.200 10.560 N Pcmt1 n/a
5 TRCN0000097400 GCCTGGTGGAAGATTGATATT pLKO.1 1001 CDS 100% 13.200 9.240 N Pcmt1 n/a
6 TRCN0000334570 GCCTGGTGGAAGATTGATATT pLKO_005 1001 CDS 100% 13.200 9.240 N Pcmt1 n/a
7 TRCN0000036403 CAGTATGACAAGCTACAAGAT pLKO.1 1059 CDS 100% 4.950 3.465 N PCMT1 n/a
8 TRCN0000300948 CAGTATGACAAGCTACAAGAT pLKO_005 1059 CDS 100% 4.950 3.465 N PCMT1 n/a
9 TRCN0000097403 GAGCAGTATGACAAGCTACAA pLKO.1 1056 CDS 100% 4.950 3.465 N Pcmt1 n/a
10 TRCN0000334571 GAGCAGTATGACAAGCTACAA pLKO_005 1056 CDS 100% 4.950 3.465 N Pcmt1 n/a
11 TRCN0000097402 CCTTACATGGATTCTCCACAA pLKO.1 612 CDS 100% 4.050 2.835 N Pcmt1 n/a
12 TRCN0000334491 CCTTACATGGATTCTCCACAA pLKO_005 612 CDS 100% 4.050 2.835 N Pcmt1 n/a
13 TRCN0000036402 CCACAATCAATAGGTTTCCAA pLKO.1 627 CDS 100% 3.000 4.200 N PCMT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347228.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11021 pDONR223 100% 72.1% 76.5% None (many diffs) n/a
2 ccsbBroad304_11021 pLX_304 0% 72.1% 76.5% V5 (many diffs) n/a
3 TRCN0000480970 ACGACCGTAACAGTGTGTCGCAGA pLX_317 56.1% 72.1% 76.5% V5 (many diffs) n/a
4 TRCN0000491746 CCAAATTATCATACTCATACACAT pLX_317 55.4% 71.6% 75.6% V5 (many diffs) n/a
5 TRCN0000488608 CCACTCAATGCCCTAATGCTGCCT pLX_317 43.6% 71.5% 75.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV