Construct: ORF TRCN0000488697
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021836.1_s317c1
- DNA Barcode:
- AGATCTAAGGGCGCCCCACTAGCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAPT (4137)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488697
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4137 | MAPT | microtubule associated prot... | NM_005910.5 | 99.9% | 99.7% | 902C>T |
| 2 | human | 4137 | MAPT | microtubule associated prot... | NM_001123067.3 | 93.3% | 93.1% | 218_219ins87;815C>T |
| 3 | human | 4137 | MAPT | microtubule associated prot... | NM_001203252.1 | 92.9% | 92.9% | 822_823ins93 |
| 4 | human | 4137 | MAPT | microtubule associated prot... | XM_005257369.4 | 86.9% | 86.7% | 426_623del;1100C>T |
| 5 | human | 4137 | MAPT | microtubule associated prot... | NM_016834.5 | 86.7% | 86.6% | 131_132ins174;728C>T |
| 6 | human | 4137 | MAPT | microtubule associated prot... | NM_001203251.2 | 86.3% | 86.3% | 218_219ins87;735_736ins93 |
| 7 | human | 4137 | MAPT | microtubule associated prot... | XM_005257370.4 | 81.1% | 81% | 218_219ins87;339_536del;1013C>T |
| 8 | human | 4137 | MAPT | microtubule associated prot... | NM_016841.5 | 79.8% | 79.8% | 131_132ins174;648_649ins93 |
| 9 | human | 4137 | MAPT | microtubule associated prot... | XM_005257371.4 | 75.4% | 75.3% | 131_132ins174;252_449del;926C>T |
| 10 | human | 4137 | MAPT | microtubule associated prot... | NM_016835.4 | 58.1% | 58% | 371_1123del;1179_1376del;1853C>T |
| 11 | human | 4137 | MAPT | microtubule associated prot... | NM_001123066.3 | 56.7% | 56.7% | (many diffs) |
| 12 | human | 4137 | MAPT | microtubule associated prot... | XM_005257367.4 | 55.3% | 55.2% | 371_1435del;1967C>T |
| 13 | human | 4137 | MAPT | microtubule associated prot... | XM_005257366.3 | 53% | 49.3% | (many diffs) |
| 14 | human | 4137 | MAPT | microtubule associated prot... | XM_005257364.4 | 52.2% | 47.6% | (many diffs) |
| 15 | human | 4137 | MAPT | microtubule associated prot... | XM_005257368.4 | 51.5% | 51.5% | 371_1435del;1887_1888ins93 |
| 16 | human | 4137 | MAPT | microtubule associated prot... | XM_005257362.4 | 51.1% | 51% | 371_1435del;1491_1688del;2165C>T |
| 17 | human | 4137 | MAPT | microtubule associated prot... | XM_005257365.4 | 47.5% | 47.5% | 371_1435del;1491_1688del;2085_2086ins93 |
| 18 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001038609.2 | 83.5% | 88.4% | (many diffs) |
| 19 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532407.3 | 77.8% | 82.6% | (many diffs) |
| 20 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532408.3 | 76.8% | 81.7% | (many diffs) |
| 21 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_010838.4 | 72.5% | 77.2% | (many diffs) |
| 22 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532409.2 | 71.1% | 75.8% | (many diffs) |
| 23 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285455.1 | 68.4% | 72.9% | (many diffs) |
| 24 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285456.1 | 65.8% | 70.4% | (many diffs) |
| 25 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285454.1 | 62.6% | 66.7% | (many diffs) |
| 26 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532410.3 | 48% | 50.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1395
- ORF length:
- 1323
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggctgag ccccgccagg agttcgaagt gatggaagat cacgctggga 121 cgtacgggtt gggggacagg aaagatcagg ggggctacac catgcaccaa gaccaagagg 181 gtgacacgga cgctggcctg aaagaatctc ccctgcagac ccccactgag gacggatctg 241 aggaaccggg ctctgaaacc tctgatgcta agagcactcc aacagcggaa gatgtgacag 301 cacccttagt ggatgaggga gctcccggca agcaggctgc cgcgcagccc cacacggaga 361 tcccagaagg aaccacagct gaagaagcag gcattggaga cacccccagc ctggaagacg 421 aagctgctgg tcacgtgacc caagctcgca tggtcagtaa aagcaaagac gggactggaa 481 gcgatgacaa aaaagccaag ggggctgatg gtaaaacgaa gatcgccaca ccgcggggag 541 cagcccctcc aggccagaag ggccaggcca acgccaccag gattccagca aaaaccccgc 601 ccgctccaaa gacaccaccc agctctggtg aacctccaaa atcaggggat cgcagcggct 661 acagcagccc cggctcccca ggcactcccg gcagccgctc ccgcaccccg tcccttccaa 721 ccccacccac ccgggagccc aagaaggtgg cagtggtccg tactccaccc aagtcgccgt 781 cttccgccaa gagccgcctg cagacagccc ccgtgcccat gccagacctg aagaatgtca 841 agtccaagat cggctccact gagaacctga agcaccagcc gggaggcggg aaggtgcaga 901 taattaataa gaagctggat cttagcaacg tccagtccaa gtgtggctca aaggataata 961 tcaaacacgt cctgggaggc ggcagtgtgc aaatagtcta caaaccagtt gacctgagca 1021 aggtgaccTC CAAGTGTGGC TCATTAGGCA ACATCCATCA TAAACCAGGA GGTGGCCAGG 1081 TGGAAGTAAA ATCTGAGAAG CTTGACTTCA AGGACAGAGT CCAGTCGAAG ATTGGGTCCC 1141 TGGACAATAT CACCCACGTC CCTGGCGGAG GAAATAAAAA GATTGAAACC CACAAGCTGA 1201 CCTTCCGCGA GAACGCCAAA GCCAAGACAG ACCACGGGGC GGAGATCGTG TACAAGTCGC 1261 CAGTGGTGTC TGGGGACACG TCTCCACGGC ATCTCAGCAA TGTCTCCTCC ACCGGCAGCA 1321 TCGACATGGT AGACTCGCCC CAGCTCGCCA CGCTAGCTGA CGAGGTGTCT GCCTCCCTGG 1381 CCAAGCAGGG TTTGTGAGAC CCAGCTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1441 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1501 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAAGATCTA AGGGCGCCCC 1561 ACTAGCCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt