Transcript: Mouse XM_006532593.2

PREDICTED: Mus musculus retinoic acid receptor, alpha (Rara), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rara (19401)
Length:
3271
CDS:
581..1969

Additional Resources:

NCBI RefSeq record:
XM_006532593.2
NBCI Gene record:
Rara (19401)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379230 TGAGGGCTTGGACACTCTAAG pLKO_005 1831 CDS 100% 10.800 15.120 N Rara n/a
2 TRCN0000222403 CCGACGAAGCATCCAGAAGAA pLKO.1 916 CDS 100% 4.950 6.930 N Rara n/a
3 TRCN0000222402 CTGAAAGTCTACGTCCGGAAA pLKO.1 1655 CDS 100% 4.050 5.670 N Rara n/a
4 TRCN0000222401 GCTCATTGAGAAGGTTCGCAA pLKO.1 1138 CDS 100% 2.640 3.696 N Rara n/a
5 TRCN0000310846 GCTCATTGAGAAGGTTCGCAA pLKO_005 1138 CDS 100% 2.640 3.696 N Rara n/a
6 TRCN0000054588 GAAATGTTTCGACGTGGGCAT pLKO.1 1018 CDS 100% 2.160 3.024 N Rara n/a
7 TRCN0000222405 TCAAGACAAATCATCCGGCTA pLKO.1 853 CDS 100% 2.160 3.024 N Rara n/a
8 TRCN0000304246 GGGAGACTCCCTGTACATATC pLKO_005 2359 3UTR 100% 10.800 7.560 N Rara n/a
9 TRCN0000020372 ACTACGAACAACAGCTCAGAA pLKO.1 1205 CDS 100% 4.950 3.465 N RARA n/a
10 TRCN0000020369 CGCATCTACAAGCCTTGCTTT pLKO.1 827 CDS 100% 4.950 3.465 N RARA n/a
11 TRCN0000054590 GAGCAGCAGTTCCGAAGAGAT pLKO.1 772 CDS 100% 4.950 3.465 N Rara n/a
12 TRCN0000301241 GAGCAGCAGTTCCGAAGAGAT pLKO_005 772 CDS 100% 4.950 3.465 N Rara n/a
13 TRCN0000054591 GCTGGAAGCACTGAAAGTCTA pLKO.1 1645 CDS 100% 4.950 3.465 N Rara n/a
14 TRCN0000331478 GCTGGAAGCACTGAAAGTCTA pLKO_005 1645 CDS 100% 4.950 3.465 N Rara n/a
15 TRCN0000275553 CATTGACCTCTGGGACAAGTT pLKO_005 1243 CDS 100% 4.950 2.970 N RARA n/a
16 TRCN0000222404 CTGATGAAGATCACAGACCTT pLKO.1 1712 CDS 100% 2.640 1.584 N Rara n/a
17 TRCN0000236362 TCTGCCAGCTGGGCAAGTATA pLKO_005 1185 CDS 100% 13.200 6.600 Y RARG n/a
18 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2983 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01375 pDONR223 100% 91.5% 98.2% None (many diffs) n/a
2 ccsbBroad304_01375 pLX_304 0% 91.5% 98.2% V5 (many diffs) n/a
3 TRCN0000492202 TTTGGTGCCCCTTCGCAGCCGACC pLX_317 8.1% 91.5% 98.2% V5 (many diffs) n/a
4 TRCN0000488701 CTCTTGACCGTCCGGCAAGACCCG pLX_317 25.8% 91.5% 98.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489444 CCTTCAACCGGCCTCAACCATGCC pLX_317 26.2% 91.4% 98% V5 (many diffs) n/a
6 ccsbBroadEn_15561 pDONR223 0% 84.1% 84.6% None (many diffs) n/a
7 ccsbBroad304_15561 pLX_304 0% 84.1% 84.6% V5 (many diffs) n/a
Download CSV