Construct: ORF TRCN0000488840
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020386.1_s317c1
- DNA Barcode:
- TCGATGGTACGGTTACAATCTGAG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NTRK3 (4916)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488840
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_002530.4 | 99.9% | 100% | 678C>T |
| 2 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720543.4 | 99.9% | 100% | 678C>T |
| 3 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022240.1 | 99.9% | 100% | 678C>T |
| 4 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001243101.1 | 99% | 98.9% | 1204_1205ins24 |
| 5 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720544.4 | 98.9% | 98.9% | 678C>T;1204_1205ins24 |
| 6 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001012338.2 | 98.3% | 98.3% | 2133_2174del |
| 7 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022253.2 | 98.2% | 98.3% | 678C>T;2133_2174del |
| 8 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022254.2 | 97% | 97% | 678C>T;2134_2208del |
| 9 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022241.1 | 91.7% | 89.5% | (many diffs) |
| 10 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022242.2 | 88.5% | 84.5% | (many diffs) |
| 11 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022243.1 | 88% | 88.1% | 0_1ins294;384C>T |
| 12 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022244.2 | 88% | 88.1% | 0_1ins294;384C>T |
| 13 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022245.2 | 88% | 88.1% | 0_1ins294;384C>T |
| 14 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449933.1 | 87.1% | 87% | 0_1ins294;384C>T;910_911ins24 |
| 15 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720545.4 | 86.3% | 86.3% | (many diffs) |
| 16 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001320135.1 | 74.5% | 74.4% | (many diffs) |
| 17 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001007156.2 | 71.1% | 65.4% | (many diffs) |
| 18 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_011521637.3 | 71.1% | 65.4% | (many diffs) |
| 19 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449934.1 | 71.1% | 65.4% | (many diffs) |
| 20 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022247.2 | 70.1% | 64.3% | (many diffs) |
| 21 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001320134.1 | 67.2% | 64.7% | (many diffs) |
| 22 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022248.2 | 66.2% | 63.6% | (many diffs) |
| 23 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449935.1 | 65.8% | 64.2% | (many diffs) |
| 24 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720548.4 | 63.9% | 64% | 678C>T;1584_1585ins891 |
| 25 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449936.1 | 59.3% | 53.7% | (many diffs) |
| 26 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720549.4 | 59.1% | 55.1% | (many diffs) |
| 27 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720550.4 | 58.2% | 54% | (many diffs) |
| 28 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022250.2 | 56.9% | 56.7% | (many diffs) |
| 29 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_011521638.3 | 56.7% | 56.4% | (many diffs) |
| 30 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_001751293.2 | 52.9% | (many diffs) | |
| 31 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022251.2 | 52.6% | 51.7% | (many diffs) |
| 32 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_002957645.1 | 51.9% | (many diffs) | |
| 33 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022252.2 | 51.9% | 49.7% | (many diffs) |
| 34 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_001751292.2 | 15.2% | 1_643del;1321C>T;3119_16213del | |
| 35 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | NM_008746.5 | 91% | 97.2% | (many diffs) |
| 36 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_011250817.2 | 89.5% | 95.5% | (many diffs) |
| 37 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_006540691.3 | 88.4% | 94.3% | (many diffs) |
| 38 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_011250816.2 | 86.9% | 92.8% | (many diffs) |
| 39 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | NM_182809.2 | 64.1% | 62.5% | (many diffs) |
| 40 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_006540692.3 | 61.1% | 61.9% | (many diffs) |
| 41 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_017322023.1 | 59.9% | 61.6% | (many diffs) |
| 42 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785487.1 | 31.7% | (many diffs) | |
| 43 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785488.1 | 30.5% | (many diffs) | |
| 44 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882023.2 | 27% | (many diffs) | |
| 45 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882022.2 | 16.9% | (many diffs) | |
| 46 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785486.1 | 16.6% | (many diffs) | |
| 47 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882025.2 | 15.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2547
- ORF length:
- 2475
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggatgtc tctctttgcc cagccaagtg tagtttctgg cggattttct 121 tgctgggaag cgtctggctg gactatgtgg gctccgtgct ggcttgccct gcaaattgtg 181 tctgcagcaa gactgagatc aattgccggc ggccggacga tgggaacctc ttccccctcc 241 tggaagggca ggattcaggg aacagcaatg ggaacgccag tatcaacatc acggacatct 301 caaggaatat cacttccata cacatagaga actggcgcag tcttcacacg ctcaacgccg 361 tggacatgga gctctacacc ggacttcaaa agctgaccat caagaactca ggacttcgga 421 gcattcagcc cagagccttt gccaagaacc cccatttgcg ttatataaac ctgtcaagta 481 accggctcac cacactctcg tggcagctct tccagacgct gagtcttcgg gaattgcagt 541 tggagcagaa ctttttcaac tgcagctgtg acatccgctg gatgcagctc tggcaggagc 601 agggggaggc caagctcaac agccagaacc tctactgcat caacgctgat ggctcccagc 661 ttcctctctt ccgcatgaac atcagtcagt gtgaccttcc tgagatcagc gtgagccacg 721 tcaacctgac cgtacgagag ggtgacaatg ctgttatcac ttgcaatggc tctggatcac 781 cccttcctga tgtggactgg atagtcactg ggctgcagtc catcaacact caccagacca 841 atctgaactg gaccaatgtt catgccatca acttgacgct ggtgaatgtg acgagtgagg 901 acaatggctt caccctgacg tgcattgcag agaacgtggt gggcatgagc aatgccagtg 961 ttgccctcac tgtctactat cccccacgtg tggtgagcct ggaggagcct gagctgcgcc 1021 tggagcactg catcgagttt gtggtgcgtg gcaacccccc accaacgctg cactggctgc 1081 acaatgggca gcctctgcgg gagtccaaga tcatccatgt ggaatactac caagagggag 1141 agatttccga gggctgcctg ctcttcaaca agcccaccca ctacaacaat ggcaactata 1201 ccctcattgc caaaaaccca ctgggcacag ccaaccagac catcaatggc cacttcctca 1261 aggagccctt tccagagagc acggataact ttatcttgtt tgacgaagtg agtcccacac 1321 ctcctatcac tgtgacccac aaaccagaag aagacacttt tggggtatcc atagcagttg 1381 gacttgctgc ttttgcctgt gtcctgttgg tggttctctt cgtcatgatc aacaaatatg 1441 gtcgacggtc caaatttgga atgaagggtc ccgtggctgt catcagtggt gaggaggact 1501 cagccagccc actgcaccac atcaaccacg gcatcaccac gccctcgtca ctggatgccg 1561 ggcccgacac tgtggtcatt ggcatgactc gcatccctgt cattgagaac ccccagtact 1621 tccgtcaggg acacaactgc cacaagccgg acacgtatgt gcagcacatt aagaggagag 1681 acatcgtgct gaagcgagaa ctgggtgagg gagcctttgg aaaggtcttc ctggccgagt 1741 gctacaacct cagcccgacc aaggacaaga tgcttgtggc tgtgaaggcc ctgaaggatc 1801 ccaccctggc tgcccggaag gatttccaga gggaggccga gctgctcacc aacctgcagc 1861 atgagcacat tgtcaagttc tatggagtgt gcggcgatgg ggaccccctc atcatggtct 1921 ttgaatacat gaagcatgga gacctgaata agttcctcag ggcccatggg ccagatgcaa 1981 tgatccttgt ggatggacag ccacgccagg ccaagggtga gctggggctc tcccaaatgc 2041 tccacattgc cagtcagatc gcctcgggta tggtgtacct ggcctcccag cactttgtgc 2101 accgagacct ggccaccagg aactgcctgg ttggagcgaa tctgctagtg aagattgggg 2161 acttcggcat gtccagagat gtctacagca cggattatta cagggtggga ggacacacca 2221 tgctcccCAT TCGCTGGATG CCTCCTGAAA GCATCATGTA CCGGAAGTTC ACTACAGAGA 2281 GTGATGTATG GAGCTTCGGG GTGATCCTCT GGGAGATCTT CACCTATGGA AAGCAGCCAT 2341 GGTTCCAACT CTCAAACACG GAGGTCATTG AGTGCATTAC CCAAGGTCGT GTTTTGGAGC 2401 GGCCCCGAGT CTGCCCCAAA GAGGTGTACG ATGTCATGCT GGGGTGCTGG CAGAGGGAAC 2461 CACAGCAGCG GTTGAACATC AAGGAGATCT ACAAAATCCT CCATGCTTTG GGGAAGGCCA 2521 CCCCAATCTA CCTGGACATT CTTGGCTAGG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 2581 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 2641 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATCGAT 2701 GGTACGGTTA CAATCTGAGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 2761 tgaaagatt