Construct: ORF TRCN0000488861
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020913.1_s317c1
- DNA Barcode:
- CGGATCCTCTTTTATTGTACGGTT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR161 (23432)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488861
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267610.1 | 100% | 100% | |
| 2 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349632.1 | 100% | 100% | |
| 3 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349633.1 | 100% | 100% | |
| 4 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349634.1 | 100% | 100% | |
| 5 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_153832.2 | 100% | 100% | |
| 6 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_005245056.2 | 100% | 100% | |
| 7 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_005245057.4 | 100% | 100% | |
| 8 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509376.2 | 100% | 100% | |
| 9 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509378.1 | 100% | 100% | |
| 10 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267611.1 | 96.8% | 96.8% | 1_51del |
| 11 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267609.1 | 96.3% | 96.3% | 1_60del |
| 12 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_005245055.2 | 96.3% | 96.3% | 1_60del |
| 13 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_006711251.1 | 95.8% | 95.8% | 1_69del |
| 14 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509371.2 | 95.8% | 95.8% | 1_69del |
| 15 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509372.1 | 95.8% | 95.8% | 1_69del |
| 16 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509373.2 | 95.8% | 95.8% | 1_69del |
| 17 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_006711253.2 | 86.8% | 86.8% | 1_240del |
| 18 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267613.1 | 81.5% | 72% | (many diffs) |
| 19 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267614.1 | 77.7% | 76.9% | (many diffs) |
| 20 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267612.1 | 75% | 75% | 0_1ins396 |
| 21 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349635.1 | 75% | 75% | 0_1ins396 |
| 22 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | NM_001310430.1 | 87.9% | 92.8% | (many diffs) |
| 23 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_006496850.3 | 87.9% | 92.8% | (many diffs) |
| 24 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_006496851.3 | 87.9% | 92.8% | (many diffs) |
| 25 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_006496852.3 | 87.9% | 92.8% | (many diffs) |
| 26 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_011238821.2 | 87.9% | 92.8% | (many diffs) |
| 27 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | NM_001310429.1 | 85.2% | 89.9% | (many diffs) |
| 28 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | NM_001081126.2 | 83.2% | 87.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1659
- ORF length:
- 1587
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgagcctc aactcctccc tcagctgcag gaaggagctg agtaatctca 121 ctgaggagga gggtggcgaa gggggcgtca tcatcaccca gttcatcgcc atcattgtca 181 tcaccatttt tgtctgcctg ggaaacctgg tcatcgtggt caccttgtac aagaagtcct 241 acctcctcac cctcagcaac aagttcgtct tcagcctgac tctgtccaac ttcctgctgt 301 ccgtgttggt gctgcctttt gtggtgacga gctccatccg cagggaatgg atctttggtg 361 tagtgtggtg caacttctct gccctcctct acctgctgat cagctctgcc agcatgctaa 421 ccctcggggt cattgccatc gaccgctact atgctgtcct gtaccccatg gtgtacccca 481 tgaagatcac agggaaccgg gctgtgatgg cacttgtcta catctggctt cactcgctca 541 tcggctgcct gccacccctg tttggttggt catccgtgga gtttgacgag ttcaaatgga 601 tgtgtgtggc tgcttggcac cgggagcctg gctacacggc cttctggcag atctggtgtg 661 ccctcttccc ctttctggtc atgctggtgt gctatggctt catcttccgc gtggccaggg 721 tcaaggcacg caaggtgcac tgtggcacag tcgtcatcgt ggaggaggat gctcagagga 781 ccgggaggaa gaactccagc acctccacct cctcttcagg cagcaggagg aatgcctttc 841 agggtgtggt ctactcggcc aaccagtgca aagccctcat caccatcctg gtggtcctcg 901 gtgccttcat ggtcacctgg ggcccctaca tggttgtcat cgcctctgag gccctctggg 961 ggaaaagctc cgtctccccg agcctggaga cttgggccac atggctgtcc tttgccagcg 1021 ctgtctgcca ccccctgatc tatggactct ggaacaagac agttcgcaaa gaactactgg 1081 gcatgtgctt tggggaccgg tattatcggg aaccatttgt gcaacgacag aggacttcca 1141 ggctcttcag catttccaac aggatcacag acctgggcct gtccccacac ctcactgcgc 1201 tcatggcagg tggacagccc ctggggcaca gcagcagcac gggggacact ggcttcagct 1261 gctcccagga ctcagggaca gatatgatgc tgcttgagga ctacacgtct gatgacaacc 1321 cTCCCTCTCA CTGCACTTGC CCACCCAAGA GAAGGAGCTC GGTGACATTT GAGGATGAAG 1381 TGGAACAAAT CAAAGAAGCT GCCAAGAACT CGATTCTTCA TGTGAAAGCT GAAGTACACA 1441 AGTCCTTGGA CAGTTACGCA GCAAGCTTGG CCAAAGCCAT TGAGGCCGAA GCCAAAATCA 1501 ACTTATTTGG GGAGGAGGCT TTGCCAGGGG TCTTGGTTAC AGCACGGACT GTCCCGGGGG 1561 GCGGCTTCGG GGGCCGCCGA GGCAGCAGAA CTCTTGTGAG CCAGAGGCTG CAGTTGCAGA 1621 GCATCGAAGA AGGAGATGTT TTAGCTGCCG AGCAGAGATA GGACCCAGCT TTCTTGTACA 1681 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1741 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1801 AGGACGACGG ATCCTCTTTT ATTGTACGGT TACGCGTTAA GTCgacaatc aacctctgga 1861 ttacaaaatt tgtgaaagat t