Construct: ORF TRCN0000489045
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019253.1_s317c1
- DNA Barcode:
- TATGCACCCAAGCTGCTGGCAGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OPN5 (221391)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489045
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 221391 | OPN5 | opsin 5 | NM_181744.3 | 100% | 100% | |
| 2 | human | 221391 | OPN5 | opsin 5 | XM_017010416.1 | 86.6% | 86.5% | 1057_1062delGACAAAinsT;1067_1224delinsA |
| 3 | human | 221391 | OPN5 | opsin 5 | XM_017010411.1 | 84.1% | 84.1% | 0_1ins168 |
| 4 | human | 221391 | OPN5 | opsin 5 | XM_017010410.1 | 59.8% | 59.8% | (many diffs) |
| 5 | human | 221391 | OPN5 | opsin 5 | XM_017010409.1 | 57.6% | 55.3% | (many diffs) |
| 6 | human | 221391 | OPN5 | opsin 5 | XM_017010412.1 | 56.4% | 56.3% | 0_1ins369;688_693delGACAAAinsT;698_855delinsA |
| 7 | human | 221391 | OPN5 | opsin 5 | XM_017010413.1 | 56.4% | 56.3% | 0_1ins369;688_693delGACAAAinsT;698_855delinsA |
| 8 | human | 221391 | OPN5 | opsin 5 | XM_017010415.1 | 46.1% | 46% | 0_1ins495;562_567delGACAAAinsT;572_729delinsA |
| 9 | human | 221391 | OPN5 | opsin 5 | XM_017010414.1 | 44.7% | 42.4% | (many diffs) |
| 10 | human | 221391 | OPN5 | opsin 5 | NR_033806.2 | 25.6% | (many diffs) | |
| 11 | mouse | 353344 | Opn5 | opsin 5 | NM_181753.4 | 83.8% | 89.3% | (many diffs) |
| 12 | mouse | 353344 | Opn5 | opsin 5 | XM_006524453.1 | 74.1% | 78.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1137
- ORF length:
- 1062
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggcg ttaaatcaca ctgccctgcc tcaggacgag cgcctgcccc 121 attaccttcg agatggggat ccttttgctt ccaaactttc ttgggaagcg gatttagtgg 181 ctggctttta cctaacaata attgggattc tgtccacatt tggaaatgga tatgtccttt 241 acatgtcttc tagacgaaag aagaagctga gacccgctga aataatgact atcaatttag 301 cagtctgtga tctggggatt tcagttgtag gcaagccgtt caccatcatc tcttgctttt 361 gtcaccgctg ggtgtttggc tggatcggct gccgctggta tggatgggct ggatttttct 421 ttggctgtgg aagccttatc accatgactg ctgtcagcct ggatcgatat ttgaaaatct 481 gctatttatc ttatggggtt tggctgaaaa gaaagcacgc ctacatctgc ctggcagcca 541 tctgggccta tgcttccttc tggaccacca tgcccttggt aggtctgggg gactacgtac 601 ctgagccctt cggaacctcg tgcaccctgg actggtggct ggcccaggcc tcggtagggg 661 gccaggtttt catcctgaac atcctcttct tctgcctctt gctcccaacg gctgtgatcg 721 tgttctccta cgtaaagatc attgccaagg ttaagtcctc TTCCAAAGAA GTAGCTCATT 781 TCGACAGTCG GATCCATAGC AGCCATGTGC TGGAAATGAA ACTGACAAAG GTAGCGATGT 841 TGATTTGTGC TGGATTCCTG ATTGCCTGGA TTCCTTATGC AGTGGTGTCT GTGTGGTCAG 901 CTTTTGGAAG GCCAGACTCC ATTCCCATAC AGCTCTCTGT GGTGCCAACC CTACTTGCAA 961 AATCTGCAGC GATGTACAAT CCCATCATTT ACCAAGTTAT TGATTACAAA TTTGCCTGTT 1021 GCCAAACTGG TGGTTTGAAA GCAACCAAGA AGAAGTCTCT GGAAGGCTTC AGGCTGCACA 1081 CCGTAACCAC AGTCAGGAAG TCTTCTGCTG TGCTGGAAAT TCATGAAGAG TGGGAAGACC 1141 CAGCTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1201 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1261 ATATATCTTG TGGAAAGGAC GATATGCACC CAAGCTGCTG GCAGGTACGC GTTAAGTCga 1321 caatcaacct ctggattaca aaatttgtga aagatt