Construct: ORF TRCN0000489075
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020361.1_s317c1
- DNA Barcode:
- CTGCCCGAGCCCAGCAATAAATTT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PHKG1 (5260)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489075
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | NM_006213.4 | 100% | 100% | |
2 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | NM_001258460.1 | 97.6% | 97.6% | 238_239ins27 |
3 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | NM_001258459.1 | 92.3% | 92.3% | 318_413del |
4 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | XM_017012324.2 | 89.5% | 89.5% | 546_680del |
5 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | XM_005271772.5 | 79.8% | 79.8% | 83_84ins234 |
6 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | XM_017012325.2 | 77% | 66.2% | 0_1ins107;155_156ins55;384_518del |
7 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | XM_017012326.2 | 71.5% | 71.5% | 83_84ins234;312_446del |
8 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | XM_017012327.2 | 65% | 65% | 0_1ins318;228_362del |
9 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | NR_047689.1 | 51.9% | 1_195del;457_458ins55;1302_2075del | |
10 | mouse | 18682 | Phkg1 | phosphorylase kinase gamma 1 | NM_011079.3 | 87.1% | 93.2% | (many diffs) |
11 | mouse | 18682 | Phkg1 | phosphorylase kinase gamma 1 | XM_011240871.2 | 63.2% | 68% | (many diffs) |
12 | mouse | 18682 | Phkg1 | phosphorylase kinase gamma 1 | NR_145486.1 | 34.4% | (many diffs) | |
13 | mouse | 18682 | Phkg1 | phosphorylase kinase gamma 1 | NR_145487.1 | 34.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1233
- ORF length:
- 1161
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgacccgg gacgaggcac tgccggactc tcattctgca caggacttct 121 atgagaatta tgagcccaaa gagatcctgg gcaggggcgt tagcagtgtg gtcaggcgat 181 gcatccacaa gcccacgagc caggagtacg ccgtgaaggt catcgacgtc accggtggag 241 gcagcttcag cccggaggag gtgcgggagc tgcgagaagc cacgctgaag gaggtggaca 301 tcctgcgcaa ggtctcaggg caccccaaca tcatacagct gaaggacact tatgagacca 361 acactttctt cttcttggtg tttgacctga tgaagagagg ggagctcttt gactacctca 421 ctgagaaggt caccttgagt gagaaggaaa ccagaaagat catgcgagct ctgctggagg 481 tgatctgcac cttgcacaaa ctcaacatcg tgcaccggga cctgaagccc gagaacattc 541 tcttggatga caacatgaac atcaagctca cagactttgg cttttcctgc cagctggagc 601 cgggagagag gctgcgagag gtctgcggga cccccagtta cctggcccct gagattatcg 661 agtgctccat gaatgaggac cacccgggct acgggaaaga ggtggacatg tggagcactg 721 gcgtcatcat gtacacgctg ctggccggct ccccgccctt ctggcaccgg aagcagatgc 781 tgatgctgag gatgatcatg agcggcaact accagtttgg ctcgcccgag tgggatgatt 841 actcggacac cgtgaaggac ctggTCTCCC GATTCCTGGT GGTGCAACCC CAGAACCGCT 901 ACACAGCGGA AGAGGCCTTG GCACACCCCT TCTTCCAGCA GTACTTGGTG GAGGAAGTGC 961 GGCACTTCAG CCCCCGGGGG AAGTTCAAGG TGATCGCTCT GACCGTGCTG GCTTCAGTGC 1021 GGATCTACTA CCAGTACCGC CGGGTGAAGC CTGTGACCCG GGAGATCGTC ATCCGAGACC 1081 CCTATGCCCT CCGGCCTCTG CGCCGGCTCA TCGACGCCTA CGCTTTCCGA ATCTATGGCC 1141 ACTGGGTGAA GAAGGGGCAG CAGCAGAACC GGGCAGCCCT TTTCGAGAAC ACACCCAAGG 1201 CCGTGCTCCT CTCCCTGGCC GAGGAGGACT ACTAGGACCC AGCTTTCTTG TACAAAGTGG 1261 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1321 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1381 ACTGCCCGAG CCCAGCAATA AATTTACGCG TTAAGTCgac aatcaacctc tggattacaa 1441 aatttgtgaa agatt