Construct: ORF TRCN0000489155
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020634.1_s317c1
- DNA Barcode:
- TCCCAAGCGGTCGCAATTATAATG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PKMYT1 (9088)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489155
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_004203.5 | 100% | 100% | |
2 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_011522734.3 | 100% | 100% | |
3 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_024450490.1 | 100% | 100% | |
4 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_001258451.2 | 98.1% | 98.1% | 0_1ins27 |
5 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_011522735.3 | 98.1% | 98.1% | 0_1ins27 |
6 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_011522736.3 | 98.1% | 98.1% | 0_1ins27 |
7 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_182687.3 | 91.3% | 89.5% | 1310_1347del;1440_1441ins95 |
8 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_001258450.2 | 85.9% | 85.3% | (many diffs) |
9 | mouse | 268930 | Pkmyt1 | protein kinase, membrane as... | NM_023058.3 | 83.9% | 87.7% | (many diffs) |
10 | mouse | 268930 | Pkmyt1 | protein kinase, membrane as... | XM_006524310.2 | 78.5% | 82% | (many diffs) |
11 | mouse | 268930 | Pkmyt1 | protein kinase, membrane as... | XM_006524311.3 | 77.9% | 81.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1569
- ORF length:
- 1497
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgctagaa cggcctcctg cactggccat gcccatgccc acggagggca 121 ccccgccacc tctgagtggc acccccatcc cagtcccagc ctacttccgc cacgcagaac 181 ctggattctc cctcaagagg cccagggggc tcagccggag cctcccacct ccgccccctg 241 ccaagggcag cattcccatc agccgcctct tccctcctcg gaccccaggc tggcaccagc 301 tgcagccccg gcgggtgtca ttccggggcg aggcctcaga gactctgcag agccctgggt 361 atgacccaag ccggccagag tccttcttcc agcagagctt ccagaggctc agccgcctgg 421 gccatggctc ctacggagag gtcttcaagg tgcgctccaa ggaggacggc cggctctatg 481 cggtaaagcg ttccatgtca ccattccggg gccccaagga ccgggcccgc aagttggccg 541 aggtgggcag ccacgagaag gtggggcagc acccatgctg cgtgcggctg gagcaggcct 601 gggaggaggg cggcatcctg tacctgcaga cggagctgtg cgggcccagc ctgcagcaac 661 actgtgaggc ctggggtgcc agcctgcctg aggcccaggt ctggggctac ctgcgggaca 721 cgctgcttgc cctggcccat ctgcacagcc agggcctggt gcaccttgat gtcaagcctg 781 ccaacatctt cctggggccc cggggccgct gcaagctggg tgacttcgga ctgctggtgg 841 agctgggtac agcaggagct ggtgaggtcc aggagggaga cccccgctac atggcccccg 901 agctgctgca gggctcctat gggacagcag cggatgtgtt cagtctgggc ctcaccatcc 961 tggaagtggc atgcaacatg gagctgcccc acggtgggga gggctggcag cagctgcgcc 1021 agggctacct gccccctgag ttcactgccg gtctgtcttc cgagctgcgt tctgtccttg 1081 tcatgatgct ggagccagac cccaagctgc gggccacggc cgaggccctg ctggcactgc 1141 ctgtgttgag gcagccgcgg gcctggggtg tgctgtggtg catggcagcg gaggccctga 1201 gccgagggtg ggccctgtgg caggccctgc ttgccctgct ctgctggcTC TGGCATGGGC 1261 TGGCTCACCC TGCCAGCTGG CTACAGCCCC TGGGCCCGCC AGCCACCCCG CCTGGCTCAC 1321 CACCCTGCAG TTTGCTCCTG GACAGCAGCC TCTCCAGCAA CTGGGATGAC GACAGCCTAG 1381 GGCCTTCACT CTCCCCTGAG GCTGTCCTGG CCCGGACTGT GGGGAGCACC TCCACCCCCC 1441 GGAGCAGGTG CACACCCAGG GATGCCCTGG ACCTAAGTGA CATCAACTCA GAGCCTCCTC 1501 GGGGCTCCTT CCCCTCCTTT GAGCCTCGGA ACCTCCTCAG CCTGTTTGAG GACACCCTAG 1561 ACCCAACCTG AGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1621 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1681 CGATTTCTTG GCTTTATATC TTGTGGAAAG GACGATCCCA AGCGGTCGCA ATTATAATGA 1741 CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg tgaaagatt