Transcript: Human XM_024450490.1

PREDICTED: Homo sapiens protein kinase, membrane associated tyrosine/threonine 1 (PKMYT1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PKMYT1 (9088)
Length:
2165
CDS:
532..2031

Additional Resources:

NCBI RefSeq record:
XM_024450490.1
NBCI Gene record:
PKMYT1 (9088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146095 GGGCCATGGCTCCTACGGAG pXPR_003 AGG 364 24% 3 0.8618 PKMYT1 PKMYT1 77278
2 BRDN0001146750 AGCAGCGGATGTGTTCAGGT pXPR_003 GGG 871 58% 4 0.4898 PKMYT1 PKMYT1 77280
3 BRDN0001148430 GGGAGAATCCAGGTTCTGCG pXPR_003 TGG 104 7% 3 0.4086 PKMYT1 PKMYT1 77279
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364118 TATGCGGTAAAGCGTTCCATG pLKO_005 937 CDS 100% 4.050 5.670 N PKMYT1 n/a
2 TRCN0000011002 CTATGCGGTAAAGCGTTCCAT pLKO.1 936 CDS 100% 3.000 4.200 N PKMYT1 n/a
3 TRCN0000364117 AGTTCACTGCCGGTCTGTCTT pLKO_005 1499 CDS 100% 4.950 3.465 N PKMYT1 n/a
4 TRCN0000364119 CTCCTACGGAGAGGTCTTCAA pLKO_005 888 CDS 100% 4.950 3.465 N PKMYT1 n/a
5 TRCN0000006237 GCTGCGTTCTGTCCTTGTCAT pLKO.1 1524 CDS 100% 4.950 3.465 N PKMYT1 n/a
6 TRCN0000364110 TGCGTTCTGTCCTTGTCATGA pLKO_005 1526 CDS 100% 4.950 3.465 N PKMYT1 n/a
7 TRCN0000364120 TGTCAAGCCTGCCAACATCTT pLKO_005 1230 CDS 100% 4.950 3.465 N PKMYT1 n/a
8 TRCN0000364112 GAACCTGGATTCTCCCTCAAG pLKO_005 637 CDS 100% 4.050 2.835 N PKMYT1 n/a
9 TRCN0000364109 TGGAAGTGGCATGCAACATGG pLKO_005 1421 CDS 100% 4.050 2.835 N PKMYT1 n/a
10 TRCN0000006236 CCTTGATGTCAAGCCTGCCAA pLKO.1 1224 CDS 100% 2.640 1.848 N PKMYT1 n/a
11 TRCN0000011003 GCCACGCAGAACCTGGATTCT pLKO.1 629 CDS 100% 1.650 1.155 N PKMYT1 n/a
12 TRCN0000006235 CCAGACTCTGCCTCTGCACTT pLKO.1 2035 3UTR 100% 1.350 0.945 N PKMYT1 n/a
13 TRCN0000199578 GCAGCGGATGTGTTCAGTCTG pLKO.1 1387 CDS 100% 1.350 0.945 N PKMYT1 n/a
14 TRCN0000199754 GTCTTCAAGGTGCGCTCCAAG pLKO.1 901 CDS 100% 1.350 0.945 N PKMYT1 n/a
15 TRCN0000199190 CTGAGTTCACTGCCGGTCTGT pLKO.1 1496 CDS 100% 0.880 0.616 N PKMYT1 n/a
16 TRCN0000194658 CTCTGCACTTTTAACCTTTTA pLKO.1 2046 3UTR 100% 0.000 0.000 N PKMYT1 n/a
17 TRCN0000195188 CCTCTGCACTTTTAACCTTTT pLKO.1 2045 3UTR 100% 0.000 0.000 N PKMYT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14928 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14928 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480261 CTTAATGCTATTAAACCTACCCGT pLX_317 21.6% 100% 100% V5 n/a
4 TRCN0000469216 ATGAATAGGTGGAGCCTTTTATGT pLX_317 22.4% 100% 100% V5 n/a
5 TRCN0000489155 TCCCAAGCGGTCGCAATTATAATG pLX_317 21.8% 100% 100% V5 (not translated due to prior stop codon) n/a
6 TRCN0000491634 TGACAAGGGTGTTAACCTTACAAT pLX_317 21.7% 99.9% 99.8% V5 1497_1498insG n/a
7 TRCN0000488460 TATGGCCTAATCTGGAGGTTGCCT pLX_317 21.9% 99.5% 99.3% V5 (not translated due to prior stop codon) 4_9delCTAGAA n/a
Download CSV