Transcript: Human NM_001258450.2

Homo sapiens protein kinase, membrane associated tyrosine/threonine 1 (PKMYT1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PKMYT1 (9088)
Length:
1854
CDS:
417..1709

Additional Resources:

NCBI RefSeq record:
NM_001258450.2
NBCI Gene record:
PKMYT1 (9088)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364118 TATGCGGTAAAGCGTTCCATG pLKO_005 615 CDS 100% 4.050 5.670 N PKMYT1 n/a
2 TRCN0000011002 CTATGCGGTAAAGCGTTCCAT pLKO.1 614 CDS 100% 3.000 4.200 N PKMYT1 n/a
3 TRCN0000364117 AGTTCACTGCCGGTCTGTCTT pLKO_005 1177 CDS 100% 4.950 3.465 N PKMYT1 n/a
4 TRCN0000364119 CTCCTACGGAGAGGTCTTCAA pLKO_005 566 CDS 100% 4.950 3.465 N PKMYT1 n/a
5 TRCN0000006237 GCTGCGTTCTGTCCTTGTCAT pLKO.1 1202 CDS 100% 4.950 3.465 N PKMYT1 n/a
6 TRCN0000364110 TGCGTTCTGTCCTTGTCATGA pLKO_005 1204 CDS 100% 4.950 3.465 N PKMYT1 n/a
7 TRCN0000364120 TGTCAAGCCTGCCAACATCTT pLKO_005 908 CDS 100% 4.950 3.465 N PKMYT1 n/a
8 TRCN0000364109 TGGAAGTGGCATGCAACATGG pLKO_005 1099 CDS 100% 4.050 2.835 N PKMYT1 n/a
9 TRCN0000006236 CCTTGATGTCAAGCCTGCCAA pLKO.1 902 CDS 100% 2.640 1.848 N PKMYT1 n/a
10 TRCN0000006235 CCAGACTCTGCCTCTGCACTT pLKO.1 1713 3UTR 100% 1.350 0.945 N PKMYT1 n/a
11 TRCN0000199578 GCAGCGGATGTGTTCAGTCTG pLKO.1 1065 CDS 100% 1.350 0.945 N PKMYT1 n/a
12 TRCN0000199754 GTCTTCAAGGTGCGCTCCAAG pLKO.1 579 CDS 100% 1.350 0.945 N PKMYT1 n/a
13 TRCN0000199190 CTGAGTTCACTGCCGGTCTGT pLKO.1 1174 CDS 100% 0.880 0.616 N PKMYT1 n/a
14 TRCN0000194658 CTCTGCACTTTTAACCTTTTA pLKO.1 1724 3UTR 100% 0.000 0.000 N PKMYT1 n/a
15 TRCN0000195188 CCTCTGCACTTTTAACCTTTT pLKO.1 1723 3UTR 100% 0.000 0.000 N PKMYT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488460 TATGGCCTAATCTGGAGGTTGCCT pLX_317 21.9% 86.2% 85.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14928 pDONR223 0% 85.9% 85.3% None (many diffs) n/a
3 ccsbBroad304_14928 pLX_304 0% 85.9% 85.3% V5 (many diffs) n/a
4 TRCN0000480261 CTTAATGCTATTAAACCTACCCGT pLX_317 21.6% 85.9% 85.3% V5 (many diffs) n/a
5 TRCN0000469216 ATGAATAGGTGGAGCCTTTTATGT pLX_317 22.4% 85.9% 85.3% V5 (many diffs) n/a
6 TRCN0000489155 TCCCAAGCGGTCGCAATTATAATG pLX_317 21.8% 85.9% 85.3% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000491634 TGACAAGGGTGTTAACCTTACAAT pLX_317 21.7% 85.8% 85.2% V5 (many diffs) n/a
Download CSV