Transcript: Mouse XM_006524310.2

PREDICTED: Mus musculus protein kinase, membrane associated tyrosine/threonine 1 (Pkmyt1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pkmyt1 (268930)
Length:
1812
CDS:
64..1683

Additional Resources:

NCBI RefSeq record:
XM_006524310.2
NBCI Gene record:
Pkmyt1 (268930)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322393 CCCAAAGACCGAACTCGTAAA pLKO_005 625 CDS 100% 10.800 15.120 N Pkmyt1 n/a
2 TRCN0000222197 CTGGACCATCTACATAGTCAA pLKO.1 844 CDS 100% 4.950 3.960 N Pkmyt1 n/a
3 TRCN0000362353 CTGGAATGTTCTGTGGTATAT pLKO_005 1275 CDS 100% 13.200 9.240 N Pkmyt1 n/a
4 TRCN0000350685 GAACTGCTGCAGGGCTCTTAT pLKO_005 1012 CDS 100% 13.200 9.240 N Pkmyt1 n/a
5 TRCN0000362274 TCTCCAGCAGCTGGGATAATG pLKO_005 1463 CDS 100% 13.200 9.240 N Pkmyt1 n/a
6 TRCN0000322330 TGGGCGACTCTATGCTGTTAA pLKO_005 579 CDS 100% 13.200 9.240 N Pkmyt1 n/a
7 TRCN0000322394 ATCCCTGTCAGCCGTCTATTC pLKO_005 364 CDS 100% 10.800 7.560 N Pkmyt1 n/a
8 TRCN0000362351 GGCTCTGGACCATCTACATAG pLKO_005 840 CDS 100% 10.800 7.560 N Pkmyt1 n/a
9 TRCN0000222198 CCATCTTGGAAGTGGCCTGTA pLKO.1 1067 CDS 100% 4.050 2.835 N Pkmyt1 n/a
10 TRCN0000222195 CGAGTCCTTCTTTCAGCAGAA pLKO.1 489 CDS 100% 4.050 2.835 N Pkmyt1 n/a
11 TRCN0000026758 ACTCGTAAACTGGCTGAGGTA pLKO.1 637 CDS 100% 2.640 1.848 N Pkmyt1 n/a
12 TRCN0000006236 CCTTGATGTCAAGCCTGCCAA pLKO.1 876 CDS 100% 2.640 1.848 N PKMYT1 n/a
13 TRCN0000364120 TGTCAAGCCTGCCAACATCTT pLKO_005 882 CDS 100% 4.950 2.970 N PKMYT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488460 TATGGCCTAATCTGGAGGTTGCCT pLX_317 21.9% 78.6% 82% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14928 pDONR223 0% 78.5% 82% None (many diffs) n/a
3 ccsbBroad304_14928 pLX_304 0% 78.5% 82% V5 (many diffs) n/a
4 TRCN0000480261 CTTAATGCTATTAAACCTACCCGT pLX_317 21.6% 78.5% 82% V5 (many diffs) n/a
5 TRCN0000469216 ATGAATAGGTGGAGCCTTTTATGT pLX_317 22.4% 78.5% 82% V5 (many diffs) n/a
6 TRCN0000489155 TCCCAAGCGGTCGCAATTATAATG pLX_317 21.8% 78.5% 82% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000491634 TGACAAGGGTGTTAACCTTACAAT pLX_317 21.7% 78.4% 81.8% V5 (many diffs) n/a
Download CSV