Construct: ORF TRCN0000489182
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021715.1_s317c1
- DNA Barcode:
- GGGCACACGGTCTCTGTGCCATAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- IGF1R (3480)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489182
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3480 | IGF1R | insulin like growth factor ... | XM_011521517.2 | 41.5% | .5% | 1_1618del |
2 | human | 3480 | IGF1R | insulin like growth factor ... | XM_011521516.2 | 35.9% | .4% | 1_2044del |
3 | human | 3480 | IGF1R | insulin like growth factor ... | XM_024449913.1 | 35.9% | .4% | 1_2044del |
4 | human | 3480 | IGF1R | insulin like growth factor ... | XM_017022139.1 | 30.7% | .4% | 1_2590del |
5 | human | 3480 | IGF1R | insulin like growth factor ... | NM_001291858.2 | 28% | .3% | 1_2950del |
6 | human | 3480 | IGF1R | insulin like growth factor ... | NM_000875.5 | 27.9% | .3% | 1_2953del |
7 | human | 3480 | IGF1R | insulin like growth factor ... | XM_017022138.1 | 27.5% | .3% | 1_3025del |
8 | human | 3480 | IGF1R | insulin like growth factor ... | XM_017022136.1 | 27.4% | .3% | 1_3028del |
9 | human | 3480 | IGF1R | insulin like growth factor ... | XM_017022137.1 | 27.4% | .3% | 1_3028del |
10 | mouse | 16001 | Igf1r | insulin-like growth factor ... | XM_017321986.1 | 31.3% | .5% | (many diffs) |
11 | mouse | 16001 | Igf1r | insulin-like growth factor ... | XM_006540645.3 | 29.3% | .4% | (many diffs) |
12 | mouse | 16001 | Igf1r | insulin-like growth factor ... | XM_006540644.3 | 28.5% | .4% | (many diffs) |
13 | mouse | 16001 | Igf1r | insulin-like growth factor ... | NM_010513.2 | 25.1% | .3% | (many diffs) |
14 | mouse | 16001 | Igf1r | insulin-like growth factor ... | XM_006540643.3 | 25.1% | .3% | (many diffs) |
15 | mouse | 16001 | Igf1r | insulin-like growth factor ... | XM_006540642.3 | 24.5% | .4% | (many diffs) |
16 | mouse | 16001 | Igf1r | insulin-like growth factor ... | XM_006540641.3 | 24.5% | .4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 85
- ORF end:
- 133
- ORF length:
- 48
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaattga 61 acccggagta cttcagcgct gctgatgtgt acgttcctga tgagtgggag gtggctcggg 121 agaagatcac catgagccgg gaacttgggc aggggtcgtt tgggatggtc tatgaaggag 181 ttgccaaggg tgtggtgaaa gatgaacctg aaaccagagt ggccattaaa acagtgaacg 241 aggccgcaag catgcgtgag aggattgagt ttctcaacga agcttctgtg atgaaggagt 301 tcaattgtca ccatgtggtg cgattgctgg gtgtggtgtc ccaaggccag ccaacactgg 361 tcatcatgga actgatgaca cggggcgatc tcaaaagtta tctccggtct ctgaggccag 421 aaatggagaa taatccagtc ctagcacctc caagcctgag caagatgatt cagatggccg 481 gagagattgc agacggcatg gcatacctca acgccaataa gttcgtccac agagaccttg 541 ctgcccggaa ttgcatggta gccgaagatt tcacagtcaa aatcggagat tttggtatga 601 cgcgagatat ctatgagaca gactattacc ggaaaggagg gaaagggctg ctgcccgtgc 661 gctggatgtc tcctgagtcc ctcaaggatg gagtcttcac cacttactcg gacgtctggt 721 ccttcggggt cgtcctctgg gagatcgcca cactggccga gcagccctac cagggcttgt 781 ccaacgagca agtccttcgc ttcgtcatgg agggcggcct tctggacaag ccagacaact 841 gtcctGACAT GCTGTTTGAA CTGATGCGCA TGTGCTGGCA GTATAACCCC AAGATGAGGC 901 CTTCCTTCCT GGAGATCATC AGCAGCATCA AAGAGGAGAT GGAGCCTGGC TTCCGGGAGG 961 TCTCCTTCTA CTACAGCGAG GAGAACAAGC TGCCCGAGCC GGAGGAGCTG GACCTGGAGC 1021 CAGAGAACAT GGAGAGCGTC CCCCTGGACC CCTCGGCCTC CTCGTCCTCC CTGCCACTGC 1081 CCGACAGACA CTCAGGACAC AAGGCCGAGA ACGGCCCCGG CCCTGGGGTG CTGGTCCTCC 1141 GCGCCAGCTT CGACGAGAGA CAGCCTTACG CCCACATGAA CGGGGGCCGC AAGAACGAGC 1201 GGGCCTTGCC GCTGCCCCAG TCTTCGACCT GCTAGGACCC AGCTTTCTTG TACAAAGTGG 1261 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1321 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1381 AGGGCACACG GTCTCTGTGC CATACACGCG TTAAGTCgac aatcaacctc tggattacaa 1441 aatttgtgaa agatt