Transcript: Human XM_017022136.1

PREDICTED: Homo sapiens insulin like growth factor 1 receptor (IGF1R), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGF1R (3480)
Length:
11738
CDS:
472..4650

Additional Resources:

NCBI RefSeq record:
XM_017022136.1
NBCI Gene record:
IGF1R (3480)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023489 GCGGTGTCCAATAACTACATT pLKO.1 1033 CDS 100% 5.625 7.875 N Igf1r n/a
2 TRCN0000121133 GCGGTGTCCAATAACTACATT pLKO.1 1033 CDS 100% 5.625 7.875 N IGF1R n/a
3 TRCN0000121196 GCTGTACGTCTTCCATAGAAA pLKO.1 3408 CDS 100% 5.625 7.875 N IGF1R n/a
4 TRCN0000039674 CGGCACAATTACTGCTCCAAA pLKO.1 2521 CDS 100% 4.950 6.930 N IGF1R n/a
5 TRCN0000000424 GCTGATGTGTACGTTCCTGAT pLKO.1 3496 CDS 100% 4.050 5.670 N IGF1R n/a
6 TRCN0000121297 CCTCTCTGCTTCATAACGGAA pLKO.1 4985 3UTR 100% 2.640 3.696 N IGF1R n/a
7 TRCN0000039677 GCCTTTCACATTGTACCGCAT pLKO.1 2928 CDS 100% 2.160 3.024 N IGF1R n/a
8 TRCN0000121192 CCTGAATCTGTGCAAACAGTA pLKO.1 4660 3UTR 100% 4.950 3.960 N IGF1R n/a
9 TRCN0000121298 CGACAGACACTCAGGACACAA pLKO.1 4497 CDS 100% 4.950 3.960 N IGF1R n/a
10 TRCN0000121301 CGGCAACCTGAGTTACTACAT pLKO.1 2460 CDS 100% 4.950 3.960 N IGF1R n/a
11 TRCN0000195002 CAACACTTAATAGCAACAGAG pLKO.1 4905 3UTR 100% 4.050 3.240 N IGF1R n/a
12 TRCN0000018331 CATGTACTGCATCCCTTGTGA pLKO.1 1500 CDS 100% 3.000 2.400 N IGF1R n/a
13 TRCN0000121134 CAAGGGCAATTTGCTCATTAA pLKO.1 1614 CDS 100% 13.200 9.240 N IGF1R n/a
14 TRCN0000199517 GCGCATGTGCTGGCAGTATAA pLKO.1 4281 CDS 100% 13.200 9.240 N IGF1R n/a
15 TRCN0000000423 GCTACCTTTACCGGCACAATT pLKO.1 2510 CDS 100% 13.200 9.240 N IGF1R n/a
16 TRCN0000121195 GTCTTCCATAGAAAGAGAAAT pLKO.1 3415 CDS 100% 13.200 9.240 N IGF1R n/a
17 TRCN0000000426 CCAAGCCTGAGCAAGATGATT pLKO.1 3865 CDS 100% 5.625 3.938 N IGF1R n/a
18 TRCN0000121132 CCTTTATCTTTCACCTTTCTA pLKO.1 5149 3UTR 100% 5.625 3.938 N IGF1R n/a
19 TRCN0000121135 GAGACAGAGTACCCTTTCTTT pLKO.1 2860 CDS 100% 5.625 3.938 N IGF1R n/a
20 TRCN0000121300 CATCAACAATGAGTACAACTA pLKO.1 1134 CDS 100% 4.950 3.465 N IGF1R n/a
21 TRCN0000121136 CCAAGGATGCACCATCTTCAA pLKO.1 1596 CDS 100% 4.950 3.465 N IGF1R n/a
22 TRCN0000005116 GATTACAGCATACACAGTGAT pLKO.1 10839 3UTR 100% 4.950 3.465 N IGF1R n/a
23 TRCN0000005118 GCCATGGACATGGGAAGACTT pLKO.1 10791 3UTR 100% 4.950 3.465 N IGF1R n/a
24 TRCN0000039675 GCCGAAGATTTCACAGTCAAA pLKO.1 3976 CDS 100% 4.950 3.465 N IGF1R n/a
25 TRCN0000005117 TGACTGCACAGCCAATGGTTT pLKO.1 10811 3UTR 100% 4.950 3.465 N IGF1R n/a
26 TRCN0000039676 CCAAATTATGTGTTTCCGAAA pLKO.1 1901 CDS 100% 4.050 2.835 N IGF1R n/a
27 TRCN0000000422 CCTTAACTGACATGGGCCTTT pLKO.1 4870 3UTR 100% 4.050 2.835 N IGF1R n/a
28 TRCN0000121299 CTTCTACTACAGCGAGGAGAA pLKO.1 4380 CDS 100% 4.050 2.835 N IGF1R n/a
29 TRCN0000000425 CCTTGGACGTTCTTTCAGCAT pLKO.1 2387 CDS 100% 2.640 1.848 N IGF1R n/a
30 TRCN0000005115 CCGTTCGGCATCTGGCTTGAT pLKO.1 10740 3UTR 100% 1.650 1.155 N IGF1R n/a
31 TRCN0000121193 CTTCGAGATGACCAATCTCAA pLKO.1 903 CDS 100% 0.495 0.347 N IGF1R n/a
32 TRCN0000010361 AAACACATTTGGGATGTTCCT pLKO.1 4809 3UTR 100% 0.000 0.000 N IGF1R n/a
33 TRCN0000039673 AACACATTTGGGATGTTCCTC pLKO.1 4810 3UTR 100% 0.000 0.000 N IGF1R n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14671 pDONR223 0% 97.2% 96.4% None (many diffs) n/a
2 ccsbBroad304_14671 pLX_304 0% 97.2% 96.4% V5 (many diffs) n/a
3 TRCN0000473406 AAAATCAGCCCATACACAGGGTTC pLX_317 10.2% 97.2% 96.4% V5 (many diffs) n/a
4 TRCN0000489071 TCACACATTATGCGGGCCCCCCCC pLX_317 7% 97.2% 96.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489368 CCGATGCCTGTCGCCGTCTGGTGA pLX_317 8.2% 97.2% 96.4% V5 (many diffs) n/a
6 TRCN0000489182 GGGCACACGGTCTCTGTGCCATAC pLX_317 33.6% 27.4% .3% V5 (not translated due to prior stop codon) 1_3028del n/a
Download CSV