Transcript: Human NM_000875.5

Homo sapiens insulin like growth factor 1 receptor (IGF1R), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
IGF1R (3480)
Length:
12235
CDS:
1044..5147

Additional Resources:

NCBI RefSeq record:
NM_000875.5
NBCI Gene record:
IGF1R (3480)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145186 GGAGAACGACCATATCCGTG pXPR_003 GGG 1783 43% 8 0.7443 IGF1R IGF1R 76692
2 BRDN0001146028 GGTACAATGTGAAAGGCCGA pXPR_003 AGG 2381 58% 11 0.2232 IGF1R IGF1R 76689
3 BRDN0001148211 TGTGGGGAATAAGCCCCCAA pXPR_003 AGG 523 13% 2 -0.6514 IGF1R IGF1R 76690
4 BRDN0001146062 TTCCGAAATTTACCGCATGG pXPR_003 AGG 1384 34% 6 -0.8020 IGF1R IGF1R 76691
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000875.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023489 GCGGTGTCCAATAACTACATT pLKO.1 1530 CDS 100% 5.625 7.875 N Igf1r n/a
2 TRCN0000121133 GCGGTGTCCAATAACTACATT pLKO.1 1530 CDS 100% 5.625 7.875 N IGF1R n/a
3 TRCN0000121196 GCTGTACGTCTTCCATAGAAA pLKO.1 3905 CDS 100% 5.625 7.875 N IGF1R n/a
4 TRCN0000039674 CGGCACAATTACTGCTCCAAA pLKO.1 3018 CDS 100% 4.950 6.930 N IGF1R n/a
5 TRCN0000000424 GCTGATGTGTACGTTCCTGAT pLKO.1 3993 CDS 100% 4.050 5.670 N IGF1R n/a
6 TRCN0000121297 CCTCTCTGCTTCATAACGGAA pLKO.1 5482 3UTR 100% 2.640 3.696 N IGF1R n/a
7 TRCN0000039677 GCCTTTCACATTGTACCGCAT pLKO.1 3425 CDS 100% 2.160 3.024 N IGF1R n/a
8 TRCN0000121192 CCTGAATCTGTGCAAACAGTA pLKO.1 5157 3UTR 100% 4.950 3.960 N IGF1R n/a
9 TRCN0000121298 CGACAGACACTCAGGACACAA pLKO.1 4994 CDS 100% 4.950 3.960 N IGF1R n/a
10 TRCN0000121301 CGGCAACCTGAGTTACTACAT pLKO.1 2957 CDS 100% 4.950 3.960 N IGF1R n/a
11 TRCN0000195002 CAACACTTAATAGCAACAGAG pLKO.1 5402 3UTR 100% 4.050 3.240 N IGF1R n/a
12 TRCN0000018331 CATGTACTGCATCCCTTGTGA pLKO.1 1997 CDS 100% 3.000 2.400 N IGF1R n/a
13 TRCN0000121134 CAAGGGCAATTTGCTCATTAA pLKO.1 2111 CDS 100% 13.200 9.240 N IGF1R n/a
14 TRCN0000199517 GCGCATGTGCTGGCAGTATAA pLKO.1 4778 CDS 100% 13.200 9.240 N IGF1R n/a
15 TRCN0000000423 GCTACCTTTACCGGCACAATT pLKO.1 3007 CDS 100% 13.200 9.240 N IGF1R n/a
16 TRCN0000121195 GTCTTCCATAGAAAGAGAAAT pLKO.1 3912 CDS 100% 13.200 9.240 N IGF1R n/a
17 TRCN0000000426 CCAAGCCTGAGCAAGATGATT pLKO.1 4362 CDS 100% 5.625 3.938 N IGF1R n/a
18 TRCN0000121132 CCTTTATCTTTCACCTTTCTA pLKO.1 5646 3UTR 100% 5.625 3.938 N IGF1R n/a
19 TRCN0000121135 GAGACAGAGTACCCTTTCTTT pLKO.1 3357 CDS 100% 5.625 3.938 N IGF1R n/a
20 TRCN0000121300 CATCAACAATGAGTACAACTA pLKO.1 1631 CDS 100% 4.950 3.465 N IGF1R n/a
21 TRCN0000121136 CCAAGGATGCACCATCTTCAA pLKO.1 2093 CDS 100% 4.950 3.465 N IGF1R n/a
22 TRCN0000005116 GATTACAGCATACACAGTGAT pLKO.1 11336 3UTR 100% 4.950 3.465 N IGF1R n/a
23 TRCN0000005118 GCCATGGACATGGGAAGACTT pLKO.1 11288 3UTR 100% 4.950 3.465 N IGF1R n/a
24 TRCN0000039675 GCCGAAGATTTCACAGTCAAA pLKO.1 4473 CDS 100% 4.950 3.465 N IGF1R n/a
25 TRCN0000005117 TGACTGCACAGCCAATGGTTT pLKO.1 11308 3UTR 100% 4.950 3.465 N IGF1R n/a
26 TRCN0000039676 CCAAATTATGTGTTTCCGAAA pLKO.1 2398 CDS 100% 4.050 2.835 N IGF1R n/a
27 TRCN0000000422 CCTTAACTGACATGGGCCTTT pLKO.1 5367 3UTR 100% 4.050 2.835 N IGF1R n/a
28 TRCN0000121299 CTTCTACTACAGCGAGGAGAA pLKO.1 4877 CDS 100% 4.050 2.835 N IGF1R n/a
29 TRCN0000000425 CCTTGGACGTTCTTTCAGCAT pLKO.1 2884 CDS 100% 2.640 1.848 N IGF1R n/a
30 TRCN0000005115 CCGTTCGGCATCTGGCTTGAT pLKO.1 11237 3UTR 100% 1.650 1.155 N IGF1R n/a
31 TRCN0000121193 CTTCGAGATGACCAATCTCAA pLKO.1 1400 CDS 100% 0.495 0.347 N IGF1R n/a
32 TRCN0000010361 AAACACATTTGGGATGTTCCT pLKO.1 5306 3UTR 100% 0.000 0.000 N IGF1R n/a
33 TRCN0000039673 AACACATTTGGGATGTTCCTC pLKO.1 5307 3UTR 100% 0.000 0.000 N IGF1R n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000875.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14671 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14671 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473406 AAAATCAGCCCATACACAGGGTTC pLX_317 10.2% 99.9% 100% V5 3984C>T n/a
4 TRCN0000489071 TCACACATTATGCGGGCCCCCCCC pLX_317 7% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489368 CCGATGCCTGTCGCCGTCTGGTGA pLX_317 8.2% 99.9% 99.9% V5 4101_4102insG n/a
6 TRCN0000489182 GGGCACACGGTCTCTGTGCCATAC pLX_317 33.6% 27.9% .3% V5 (not translated due to prior stop codon) 1_2953del n/a
Download CSV