Construct: ORF TRCN0000489186
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021179.1_s317c1
- DNA Barcode:
- TCCCACCTGGCTCAATCGAAGTGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- OPN5 (221391)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489186
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 221391 | OPN5 | opsin 5 | NM_181744.3 | 100% | 100% | |
| 2 | human | 221391 | OPN5 | opsin 5 | XM_017010416.1 | 86.6% | 86.5% | 1057_1062delGACAAAinsT;1067_1224delinsA |
| 3 | human | 221391 | OPN5 | opsin 5 | XM_017010411.1 | 84.1% | 84.1% | 0_1ins168 |
| 4 | human | 221391 | OPN5 | opsin 5 | XM_017010410.1 | 59.8% | 59.8% | (many diffs) |
| 5 | human | 221391 | OPN5 | opsin 5 | XM_017010409.1 | 57.6% | 55.3% | (many diffs) |
| 6 | human | 221391 | OPN5 | opsin 5 | XM_017010412.1 | 56.4% | 56.3% | 0_1ins369;688_693delGACAAAinsT;698_855delinsA |
| 7 | human | 221391 | OPN5 | opsin 5 | XM_017010413.1 | 56.4% | 56.3% | 0_1ins369;688_693delGACAAAinsT;698_855delinsA |
| 8 | human | 221391 | OPN5 | opsin 5 | XM_017010415.1 | 46.1% | 46% | 0_1ins495;562_567delGACAAAinsT;572_729delinsA |
| 9 | human | 221391 | OPN5 | opsin 5 | XM_017010414.1 | 44.7% | 42.4% | (many diffs) |
| 10 | human | 221391 | OPN5 | opsin 5 | NR_033806.2 | 25.6% | (many diffs) | |
| 11 | mouse | 353344 | Opn5 | opsin 5 | NM_181753.4 | 83.8% | 89.3% | (many diffs) |
| 12 | mouse | 353344 | Opn5 | opsin 5 | XM_006524453.1 | 74.1% | 78.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1134
- ORF length:
- 1062
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcgtta aatcacactg ccctgcctca ggacgagcgc ctgccccatt 121 accttcgaga tggggatcct tttgcttcca aactttcttg ggaagcggat ttagtggctg 181 gcttttacct aacaataatt gggattctgt ccacatttgg aaatggatat gtcctttaca 241 tgtcttctag acgaaagaag aagctgagac ccgctgaaat aatgactatc aatttagcag 301 tctgtgatct ggggatttca gttgtaggca agccgttcac catcatctct tgcttttgtc 361 accgctgggt gtttggctgg atcggctgcc gctggtatgg atgggctgga tttttctttg 421 gctgtggaag ccttatcacc atgactgctg tcagcctgga tcgatatttg aaaatctgct 481 atttatctta tggggtttgg ctgaaaagaa agcacgccta catctgcctg gcagccatct 541 gggcctatgc ttccttctgg accaccatgc ccttggtagg tctgggggac tacgtacctg 601 agcccttcgg aacctcgtgc accctggact ggtggctggc ccaggcctcg gtagggggcc 661 aggttttcat cctgaacatc ctcttcttct gcctcttgct cccaacggct gtgatcgtgt 721 tctcctacgt aaagatcatt gccaaggtta agtcctcttc caaagaagta gctcatTTCG 781 ACAGTCGGAT CCATAGCAGC CATGTGCTGG AAATGAAACT GACAAAGGTA GCGATGTTGA 841 TTTGTGCTGG ATTCCTGATT GCCTGGATTC CTTATGCAGT GGTGTCTGTG TGGTCAGCTT 901 TTGGAAGGCC AGACTCCATT CCCATACAGC TCTCTGTGGT GCCAACCCTA CTTGCAAAAT 961 CTGCAGCGAT GTACAATCCC ATCATTTACC AAGTTATTGA TTACAAATTT GCCTGTTGCC 1021 AAACTGGTGG TTTGAAAGCA ACCAAGAAGA AGTCTCTGGA AGGCTTCAGG CTGCACACCG 1081 TAACCACAGT CAGGAAGTCT TCTGCTGTGC TGGAAATTCA TGAAGAGTGG GAATAAGACC 1141 CAGCTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1201 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1261 ATATATCTTG TGGAAAGGAC GATCCCACCT GGCTCAATCG AAGTGCACGC GTTAAGTCga 1321 caatcaacct ctggattaca aaatttgtga aagatt