Construct: ORF TRCN0000489265
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021824.1_s317c1
- DNA Barcode:
- TAAAGTCAATTACTGTATAGATGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAPT (4137)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489265
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4137 | MAPT | microtubule associated prot... | NM_005910.5 | 100% | 100% | |
| 2 | human | 4137 | MAPT | microtubule associated prot... | NM_001123067.3 | 93.4% | 93.4% | 218_219ins87 |
| 3 | human | 4137 | MAPT | microtubule associated prot... | NM_001203252.1 | 92.9% | 92.9% | 822_823ins93 |
| 4 | human | 4137 | MAPT | microtubule associated prot... | XM_005257369.4 | 86.9% | 86.9% | 426_623del |
| 5 | human | 4137 | MAPT | microtubule associated prot... | NM_016834.5 | 86.8% | 86.8% | 131_132ins174 |
| 6 | human | 4137 | MAPT | microtubule associated prot... | NM_001203251.2 | 86.3% | 86.3% | 218_219ins87;735_736ins93 |
| 7 | human | 4137 | MAPT | microtubule associated prot... | XM_005257370.4 | 81.2% | 81.2% | 218_219ins87;339_536del |
| 8 | human | 4137 | MAPT | microtubule associated prot... | NM_016841.5 | 79.8% | 79.8% | 131_132ins174;648_649ins93 |
| 9 | human | 4137 | MAPT | microtubule associated prot... | XM_005257371.4 | 75.5% | 75.5% | 131_132ins174;252_449del |
| 10 | human | 4137 | MAPT | microtubule associated prot... | NM_016835.4 | 58.1% | 58.1% | 371_1123del;1179_1376del |
| 11 | human | 4137 | MAPT | microtubule associated prot... | NM_001123066.3 | 56.8% | 56.8% | 371_1123del;1179_1376del;1507_1560del |
| 12 | human | 4137 | MAPT | microtubule associated prot... | XM_005257367.4 | 55.4% | 55.4% | 371_1435del |
| 13 | human | 4137 | MAPT | microtubule associated prot... | XM_005257366.3 | 53% | 49.5% | (many diffs) |
| 14 | human | 4137 | MAPT | microtubule associated prot... | XM_005257364.4 | 52.2% | 47.7% | (many diffs) |
| 15 | human | 4137 | MAPT | microtubule associated prot... | XM_005257368.4 | 51.5% | 51.5% | 371_1435del;1887_1888ins93 |
| 16 | human | 4137 | MAPT | microtubule associated prot... | XM_005257362.4 | 51.1% | 51.1% | 371_1435del;1491_1688del |
| 17 | human | 4137 | MAPT | microtubule associated prot... | XM_005257365.4 | 47.5% | 47.5% | 371_1435del;1491_1688del;2085_2086ins93 |
| 18 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001038609.2 | 83.6% | 88.7% | (many diffs) |
| 19 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532407.3 | 77.8% | 82.8% | (many diffs) |
| 20 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532408.3 | 76.8% | 81.7% | (many diffs) |
| 21 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_010838.4 | 72.6% | 77.4% | (many diffs) |
| 22 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532409.2 | 71.1% | 75.8% | (many diffs) |
| 23 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285455.1 | 68.4% | 73.1% | (many diffs) |
| 24 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285456.1 | 65.8% | 70.4% | (many diffs) |
| 25 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285454.1 | 62.6% | 66.7% | (many diffs) |
| 26 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532410.3 | 48.1% | 50.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1392
- ORF length:
- 1323
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggctgagccc cgccaggagt tcgaagtgat ggaagatcac gctgggacgt 121 acgggttggg ggacaggaaa gatcaggggg gctacaccat gcaccaagac caagagggtg 181 acacggacgc tggcctgaaa gaatctcccc tgcagacccc cactgaggac ggatctgagg 241 aaccgggctc tgaaacctct gatgctaaga gcactccaac agcggaagat gtgacagcac 301 ccttagtgga tgagggagct cccggcaagc aggctgccgc gcagccccac acggagatcc 361 cagaaggaac cacagctgaa gaagcaggca ttggagacac ccccagcctg gaagacgaag 421 ctgctggtca cgtgacccaa gctcgcatgg tcagtaaaag caaagacggg actggaagcg 481 atgacaaaaa agccaagggg gctgatggta aaacgaagat cgccacaccg cggggagcag 541 cccctccagg ccagaagggc caggccaacg ccaccaggat tccagcaaaa accccgcccg 601 ctccaaagac accacccagc tctggtgaac ctccaaaatc aggggatcgc agcggctaca 661 gcagccccgg ctccccaggc actcccggca gccgctcccg caccccgtcc cttccaaccc 721 cacccacccg ggagcccaag aaggtggcag tggtccgtac tccacccaag tcgccgtctt 781 ccgccaagag ccgcctgcag acagcccccg tgcccatgcc agacctgaag aatgtcaagt 841 ccaagatcgg ctccactgag aacctgaagc accagccggg aggcgggaag gtgcagataa 901 ttaataagaa gctggatctt agcaacgtcc agtccaagtg tggctcaaag gataatatca 961 aacacgtccc gggaggcggc agtgtgcaaa tagtctacaa accagttgac ctgagcaagg 1021 tgacctccaa gtgtggctca ttaggcaaca TCCATCATAA ACCAGGAGGT GGCCAGGTGG 1081 AAGTAAAATC TGAGAAGCTT GACTTCAAGG ACAGAGTCCA GTCGAAGATT GGGTCCCTGG 1141 ACAATATCAC CCACGTCCCT GGCGGAGGAA ATAAAAAGAT TGAAACCCAC AAGCTGACCT 1201 TCCGCGAGAA CGCCAAAGCC AAGACAGACC ACGGGGCGGA GATCGTGTAC AAGTCGCCAG 1261 TGGTGTCTGG GGACACGTCT CCACGGCATC TCAGCAATGT CTCCTCCACC GGCAGCATCG 1321 ACATGGTAGA CTCGCCCCAG CTCGCCACGC TAGCTGACGA GGTGTCTGCC TCCCTGGCCA 1381 AGCAGGGTTT GTGAGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1441 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1501 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TAAAGTCAAT TACTGTATAG 1561 ATGCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt